Labshake search
Citations for New England Biolabs :
51 - 100 of 3630 citations for 7 NITRO 3 4 DIHYDRO 1H QUINOXALIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was phosphorylated for 1h at 37°C with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Microbiology 2022Quote: ... and exon 7 (BSErI, NEB). PCR amplicons were also purified with MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Systems Biology 2020Quote: ... The resulting PCR products were digested for 1h at 37°C with DpnI (NEB) and transformed in competent Escherichia coli MC1061 cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Backbones were linearized with PCR or with restriction enzymes (NEB, 1h at 37°C). PCR-amplified or digested products were purified (Monarch PCR & DNA Cleanup Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... Digested DNA was dephosphorylated for 1h by 10U of antartic phosphatase (New England Biolabs). DNA adaptator was ligated overnight with 2,000 u of T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... trp-31 his-1 rpsL104 xyl-7 mtl-2 metB1 Δ(mcrC-mrr)114::IS10 argE::Hsmar1-lacZ’-kanR] was derived from ER1793 (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... One μL APOBEC3A (NEB #E7120S) was added directly to the reaction with 10 μL of 10x APOBEC3A reaction buffer and 1 μL BSA (10 mg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution (NEB) DNase digestions were performed ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Immunology 2023Quote: ... PCR was performed with 2 ng of library input per reaction and 7 cycles of amplification using Q5 DNA polymerase (New England Biolabs, catalog # M0491S). Libraries were quantified using a Qubit 4 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Genes of interest were amplified with the One Taq One-Step RT-PCR kit (NEB) using 1 μg of RNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...