Labshake search
Citations for New England Biolabs :
1 - 50 of 6934 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Genomics 2019Quote: ... 500 µM each of 5’-methyl-dCTP (NEB N0356S), dATP ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...