Labshake search
Citations for New England Biolabs :
651 - 700 of 2797 citations for 7 Chlorothieno 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 3 mM CaCl2) and was subjected to mild MNase (NEB, M0247S) treatment (20 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Genomics 2023Quote: ... 25 pmol of SSAs were folded in 1x NEBuffer 3 (NEB) by heating at 95°C for 5 min followed by slow cooling to 25°C ...
-
bioRxiv - Genomics 2023Quote: ... was digested for 3 hours with PvuII-HF (NEB cat #R3151S) or PstI (NEB cat #R0140T ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL of T4 RNA ligase buffer (NEB, cat. no: M0204S), 1 μL of 10 mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The radioactive probes were prepared by end labelling 10 pmoles of DNA oligonucleotide complementary to the sfRNA (Supplementary table 7) with [γ-32P]-ATP (Perkin-Elmer, USA) using T4 polynucleotide kinase (NEB, USA). Unincorporated nucleotides were then removed by gel filtration on Illustra MicroSpin G-25 Columns (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: ... The PCR enrichment of adaptor-ligated DNA was conducted with 7 cycles and NEBNext® Multiplex Oligos for Illumnina® (NEB, USA) for single end barcoding ...
-
bioRxiv - Microbiology 2020Quote: ... as previously described[7] Phage DNA libraries were prepared using NEBNext Ultra II FS library Prep and Kit for Illumina (New England Biolabs, Ipswich, USA). The sequencing was performed on the Illumina iSeq platform as part of a flowcell (2 x 151 ...
-
bioRxiv - Genomics 2021Quote: ... 1000 ng samples of high quality total RNA (RIN≥ 7) was used for mRNA isolation using NEBNext Ploy(A) mRNA Magnetic Isolation module (New England Biolabs, catalog # E7490), followed by RNA library construction with NEBNext Ultra II Directional Lib Prep (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was isolated from 50ng of total RNA (RIN value >7) using the NEBNext® Poly(A) mRNA magnetic isolation module, (New England BioLabs, Hitichin, Herts, UK) (NEB, #E7490) and the sequencing libraries were prepared using the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... allowing a minimum RNA integrity number (RIN) of 7 (Schroeder et al., 2006) before fragmentation using NEBNext® Magnesium RNA Fragmentation Module (NEB, Ipswich, MA) into short fragments using divalent cations under high temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was extracted from 30-35 sets of MTs isolated from 5-7-day old female flies in five independent biological replicates using the Monarch Total RNA Miniprep kit (New England BioLabs, Whitby, ON, Canada). Total RNA was quantified using a UV spectrophotometer (Synergy 2 microplate reader ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...