Labshake search
Citations for New England Biolabs :
101 - 150 of 4842 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 8 μL 5x first-strand buffer (NEB), 2 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 8 μl DpnII (400 U, NEB, R0543M) was added to each and samples were incubated at 37°C overnight with rotation.
-
bioRxiv - Bioengineering 2019Quote: ... 8 U/µl Taq DNA ligase (NEB), 2 mM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl NEB RNase If (NEB M0243S) per OD260 of ~10 was added in 2ml of lysis buffer ...
-
bioRxiv - Biophysics 2020Quote: ... and loading dye (8 μL, B0363S, NEB) and loaded denatured (70 °C ...
-
bioRxiv - Physiology 2019Quote: ... and 8 μl of PNGase F (NEB) were added ...
-
bioRxiv - Immunology 2020Quote: ... or 8 μM bortezomib (BTZ; LC Biolabs). Mock treatment consisted of an equivalent volume of the matching solvent ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 U murine RNase inhibitor (NEB # M0314), 0-1 μM recombinant protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 U murine RNase inhibitor (NEB # M0314L), and 0-3.4 μM recombinant protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro methylation experiments were performed for 10 min (DNA) or 1 h (RNA) at 37 °C in 8 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 20 nM DNA or 50 nM RNA with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... formic acid was purchased from Biolabs ltd ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Oligonucleotides (1) and (4) were phosphorylated with T4 PNK (New England Biolabs) to allow ligation to the backbone fragment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Bioengineering 2020Quote: ... Constriction was performed by diluting a library to approximately 8 fM (~5,000 molecules/μl) in salmon sperm DNA (1 ng/μl, New England Biolabs) in low-binding tubes (LoBind ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Genomics 2020Quote: ... 0.2% SDS) with 8 μL Proteinase K (NEB) at 65°C for 1 hour ...
-
bioRxiv - Genetics 2020Quote: ... 8 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 8 μl of phosphatase reaction buffer (NEB). After incubation at 30°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 U/ml DNaseI (RNase-free, NEB, M0303L) were added to each sample ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 U/ml proteinase K (New England Biolabs) diluted in digestion buffer (containing 50 mM Tris pH 8.0 (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... along with 8 units of RNAse inhibitor (NEB), and 10 µm malachite green oxalate added to each reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...