Labshake search
Citations for New England Biolabs :
601 - 650 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 1× CutSmart Buffer (NEB) in nuclease-free water to form RNPs ...
-
bioRxiv - Genomics 2020Quote: ... and NEBuffer 1 (NEB) to the library and incubated at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2019Quote: ... Apyrase (1 unit, NEB) was added and incubated overnight at 4° C ...
-
bioRxiv - Genetics 2021Quote: ... rSAP (1 Unit, NEB) and RNasin (20 units ...
-
bioRxiv - Genetics 2020Quote: ... 1:50 (NEB, 14001), (5 ...
-
bioRxiv - Genetics 2020Quote: ... 1:100 (NEB, 51255), (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligase 1 (NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM NAD+ (NEB) and water to a volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM ATP (NEB), 4 mM DTT (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl RNaseOut (NEB), 2 μl of 100 μM TSO ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl DpnI (NEB) was added to the PCR mix ...
-
bioRxiv - Genomics 2023Quote: ... and 1× Thermopol (NEB) at 72°C for 60 min ...
-
bioRxiv - Genomics 2024Quote: ... 1% BSA (NEB, B9000S), and 1U/ml Protector RNase Inhibitor (between 100-200 μl depending on pellet volume) ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Microbiology 2024Quote: ... 1 mM NAD+ (NEB), 4 µg of DNA or RNA oligo ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer, NEB, 1 µL of 100 µM gapmer, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP, Hartmann, 6 µL ddH2O) for 40 min at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: ... One microgram of purified RNA was fragmented at 95 °C for 7 min in 1X T4 RNA Ligase buffer (NEB) with an equal volume of 2X alkaline fragmentation buffer (0.6 volumes of 100 mM Na2CO3 plus 4.4 volumes of 100 mM NaHCO3) ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and then added up to 5 fmol DNA (2000:1000:1 RNA:protein:DNA ratio) and NEBuffer 3.1 (NEB) to 1X ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragmentation of 1 µg mRNA aliquots for 5 min at 94°C in 1x Fragmentation Buffer (NEB) was optimal to obtain a pool of 100-200 nt fragments ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of 5 μM annealed adaptors and 10 μL of Blunt/TA ligase master mix (NEB) was added to each reaction ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Free adaptor was then removed by addition of 1 μL 10 U/μL 5’-Deadenylase (NEB, M0331S). 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre ...
-
bioRxiv - Genetics 2022Quote: ... The 5’ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15 °C for 4 hours ...
-
bioRxiv - Microbiology 2023Quote: ... pETduet-1::5′-flank_SpecPromoter_kanR_3′-flank and were subsequently digested from the plasmid using BamHI and NotI (NEB). The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Physiology 2023Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...