Labshake search
Citations for New England Biolabs :
151 - 200 of 5842 citations for 7 Chloro 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Oligonucleotides (1) and (4) were phosphorylated with T4 PNK (New England Biolabs) to allow ligation to the backbone fragment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl of proteinase k (800 units ml-1, NEB) were added and reacted for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of NEBuffer 2 (New England BioLabs #B7002S), then heating in a thermocycler at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...