Labshake search
Citations for New England Biolabs :
251 - 300 of 5921 citations for 7 BROMO 2 1 3 BENZOTHIADIAZOLE 4 SULFINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Genetics 2020Quote: Total RNA was extracted using the standard hot acid phenol method and treated with DNase 1 (New England Biolabs). qRT-PCR was performed using amfiRivert cDNA synthesis Platinum Master Mix from Gendepot ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was purified from single-humanized Hsα1 and quintuple-humanized Hsα1,α2,α3,α4,α7 strains using the Monarch Nucleic acid purification kit according to the manufacturer’s protocol (NEB). Spheroplasts were obtained before the genomic DNA extraction for a high-quality DNA prep ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... gRNAs were annealed in (1 μl Forward primer, 1 μl Reverse primer, 5 μl Buffer 4 NEB, 43 μl H2O) by heating at 98 °C for 5 min and allowing the tubes to cool down to room temperature in the thermoblock (∼3h) ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Microbiology 2023Quote: Verified amplicons were combined with the pMV306H integrative vector backbone at a ratio of 1:1 v/v and allowed to ligate overnight at 4°C with T4 DNA ligase (NEB). Ligation products were subsequently transformed into chemically competent DH5ɑ E.coli ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...