Labshake search
Citations for New England Biolabs :
201 - 250 of 5883 citations for 7 BROMO 1 2 3 4 TETRAHYDROCYCLOPENTA B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl of proteinase k (800 units ml-1, NEB) were added and reacted for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of NEBuffer 2 (New England BioLabs #B7002S), then heating in a thermocycler at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Genomics 2019Quote: ... in 1× Buffer 3 (Bionano Genomics) or 120 U of Nb.BssSI (New England Biolabs) in 1× NEBuffer 3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these products were ligated to a 3’ adapter (1× T4 RNA ligase buffer (NEB), 10% PEG-8000 ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for Level 1 and 3 assembly and SapI (New England BioLabs, USA) for Level 2 assembly ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genetics 2019Quote: ... in 7 ml of ligation cocktail including 1.1 × ligation buffer (NEB) and 10% Triton X-100 for 2 hours at 16°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 ng gBlock template and 1 Unit Phusion High-Fidelity DNA polymerase (NEB). The reaction was subjected to a 2-minute initial denaturation at 98 °C ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation for 1 hr with 4 units of DNase I (NEB) at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...