Labshake search
Citations for New England Biolabs :
501 - 550 of 6985 citations for 7 Amino 8 oxo 3 cis prop 1 enyl 5 thia 1 azabicyclo 4.2.0 oct 2 ene 2 carboxylic acid diphenylmethyl ester hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Master mix was added to each sample together with 1 µl truncated T4 RNA Ligase 2 (#M0239, NEB; Frankfurt/Main, Germany). Ligation was carried out for 2 h at 23°C and nucleic acids were precipitated ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Pathology 2019Quote: ... protocol using the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit (ONT) and LongAmp Taq 2× Master Mix (New England Biolabs, MA) with the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... was linerized by inverse PCR with primers 13 and 14 and the duplex oligo was ligated to the linearized plasmid in a 2:1 insert:vector molar ratio using NEBuilder Hifi Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Biochemistry 2022Quote: ... the corresponding single and multiple amino acid substitutions were introduced by QuikChange site-directed mutagenesis (NEB, Phusion High-Fidelity PCR Kit) followed by KLD (Kinase ...
-
bioRxiv - Neuroscience 2020Quote: ... amino acid sequence identical to GenBank: BC002453.2) was amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich MA, USA) and inserted into the TOPO cloning site in pET151/D-TOPO E ...
-
bioRxiv - Molecular Biology 2021Quote: ... or more amino acid substitutions in SecPH with Q5 PCR methodology (Q5®Site-Directed Mutagenesis Kit, New England Biolabs, E0554) or PCR site-directed mutagenesis strategy ...
-
bioRxiv - Microbiology 2021Quote: ... The OprCAA mutant was produced by changing the key amino acids Cys143 and Met147 to alanine residues using the KLD Quickchange site-directed mutagenesis kit (New England Biolabs, UK) and specific primers containing both mutation sites (forward ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...