Labshake search
Citations for New England Biolabs :
351 - 400 of 509 citations for 7 8 Dihydro 6 5H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μg of digested nucleic acids were treated or not with 10 μl of RNase H (New England BioLabs, M029L) overnight at 37 °C in 1x RNAse H buffer and 1/10 of the samples were used as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Chromatin was then digested by adding 12 μl of 10x NEBuffer3.1 and 8 μl of 5 U/μl DpnII (NEB, R0543) followed by a 2h incubation at 37ºC in a ThermoMixer with shaking (900 rpm ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Biophysics 2019Quote: ... 10 μl of 100 μM DNA oligos containing an amino group modification at their 5’ends were mixed with 8 μl of 20 mM BG-GLA-NHS (NEB) in 40 μl of 50 mM HEPES buffer containing 50% anhydrous DMSO ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Physiology 2020Quote: ... RNA with RIN>8 was used to prepare transcriptomic libraries using the NEBNext Ultra RNA library prep kit (New England Biolabs). High throughput RNA-Sequencing was performed at the NIDDK Genomic Core Facility (NIH ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Physiology 2019Quote: ... Qualifying samples (samples with RNA integrity numbers > 8) were then prepared following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified DNA was resuspended in 10 mM Tris pH 8 and prepared for sequencing using the NEBNext Ultra II DNA library kit for Illumina (New England Biolabs). Paired-end sequencing with 75 cycles and a 6-cycle index read was performed on the Illumina NextSeq500 system.
-
bioRxiv - Cancer Biology 2020Quote: ... 30 ng total RNA (RQI≥8) was used for library preparation following the NEBNext Ultra RNA Library Prep Kit for Illumina protocol (New England BioLabs) with the Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: Samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8, 50 mM NaCl, 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 8-16 hours at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Genomics 2023Quote: ... The resulting digested DNA (4 ml in total) was divided into four aliquots and diluted in 8 ml of ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... and 7 PCR cycles were used to amplified libraries using NEBnext High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich MA, Catalog #M0541S) and SYBR Green I (ThermoFisher ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Synthetic Biology 2019Quote: Fly genomic DNA was isolated in a pool by grinding in 25 µl of “Squish Buffer” (10 mM Tris, 1 mM EDTA, 25 mM NaCl, 8 U/ml ProK (NEB P8107S)) per adult ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Microbiology 2020Quote: ... After adding 10% 1M sodium dodecyl sulphate (SDS) and 10 μL of 8 U/mL proteinase K (NEB, #P8107S, Ipswich, MA), the suspension was then incubated at 56°C for 4 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...