Labshake search
Citations for New England Biolabs :
151 - 200 of 6463 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genetics 2019Quote: ... in 7 ml of ligation cocktail including 1.1 × ligation buffer (NEB) and 10% Triton X-100 for 2 hours at 16°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of DNA was mixed with 7 µl NEBNext Ultra II end prep reaction buffer (NEB) and 3 µl Ultra II end prep enzyme mix (NEB) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...