Labshake search
Citations for New England Biolabs :
551 - 600 of 7285 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR product (2 μg) and pEYFP-C1 vector DNA (2 μg) were digested with BamHI-HF and HindIII-HF (New England Biolabs) according to the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The annealing was carried out in 96-well PCR plates by mixing 2 μL of each oligonucleotide at 100 μM with 2 μL of 10x T4 DNA Ligase Reaction Buffer (NEB) and 14 μL of water ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR reactions with plasmid and genomic DNA templates were performed using the Phusion High-Fidelity 2× Master Mix or Q5 High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Microbiology 2022Quote: ... human NINL isoform 2 (NCBI accession NM_001318226.2) and the NINL isoform 2 mutant (Q231R) were mutagenized using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The plasmids encoding 3C proteases (coxsackievirus B3 (CVB3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we first mixed 10.5 uL of purified RNA with 2 uL of 2 uM RT primer (AGGGACATCGTAGAGAGTCGTACTTANNNNNNNNNNAGATGAACTTCAGGGTCAGC, where Ns comprise the UMI) and 2uL of 10mM dNTP mixture (NEB), incubated the mixture at 65C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... A repair template for editing endogenous plk-2 gene to express PLK-2::3xFLAG::TIR1CIP was assembled into a pCR-Blunt backbone using Gibson Assembly (NEB) and confirmed using Sanger sequencing and whole-plasmid Nanopore sequencing (Primordium) ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Cancer Biology 2022Quote: ... to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. # M0351L). The resulting tRNAs were then ligated to a 5’-adaptor ...
-
bioRxiv - Plant Biology 2023Quote: ... Whole genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl seq kit (New England BioLabs® Inc., Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Molecular Biology 2021Quote: ... 41.7 µL of Phusion 2× Master Mix (NEB), 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors) ...
-
bioRxiv - Genomics 2019Quote: ... 10 μl NEB Buffer 2 (New England Biolabs), 12 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM ribonucleoside vanadyl complex (RVC) (NEB, S1402), 0.02% RNase-free BSA (Ambion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated with 2 units of DNase I (NEB) at 37°C for 1 hour followed by DNase I heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl Antarctic Phosphatase [5k U/mL] (NEB) and 1 μl RNase inhibitor and incubating at 37 °C for 30 minutes with shaking ...
-
bioRxiv - Genomics 2021Quote: ... 10 µL of 2% BSA (New England Biolabs), 930 µL of nuclease-free water and supplemented with 0.2 U/ul RNaseIN Plus (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl RNase Inhibitor (80U final, NEB M0307L) and 2 µl SuperScript III (400U final ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl RNase Inhibitor (80U final, NEB M0307L) and 1 µl AMV RT (12U final ...
-
bioRxiv - Genetics 2021Quote: ... viewpoint 2: 10X NEBuffer™ DpnII (R0543M, NEB)) and 15 μl of 10% SDS buffer were added to the 450 μl sample ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl 10x CutSmart buffer (New England Biolabs), 10 μl shrimp alkaline phosphatase (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl 10× T4 RNA ligase buffer (NEB), 20 U T4 RNA ligase enzyme ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl of 10× Antarctic Phosphatase buffer (NEB), 1 U Antarctic Phosphatase ...