Labshake search
Citations for New England Biolabs :
251 - 300 of 1348 citations for 6 chloropyridazine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 µM p-Nitrophenyl Phosphate (pNPP) (New England Biolabs Catalog Number P0757S) at 25°C at a pH of 5.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sfGFP1-6-CAM-CB5-mRuby3 were inserted using Gibson assembly (NEB E2611). The insert was amplified with the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... CLAMT1c-Iso2 (Supplementary table 6) were amplified by Phusion polymerase (New England Biolabs) from cDNA (CLAMT1b ...
-
bioRxiv - Biochemistry 2024Quote: ... Eluted proteins were loaded onto a 6 mL amylose column (New England Biolabs), washed in 50 mM HEPES-KOH (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and 3 protease inhibitor cocktail tablets (New England Biolabs) were added to the cell suspension ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 μL of CutSmart buffer (New England Biolabs) with 4 μL of sterile water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 μl Klenow Fragment (exonuclease-deficient; M0212, NEB). The HDMI-array was incubated at 37 °C for 2 hr in a humidity-controlled chamber.
-
bioRxiv - Microbiology 2020Quote: ... 3’ blocked oligodeoxynucleotide RNA linker (S1315S, New England BioLabs) was ligated to the 3’ ends of RNAs by incubation with RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 µl USER® Enzyme (New England BioLabs) was used with size-selected ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 µl of G3 reaction buffer (NEB, MA) and 2 µl PNGase F (NEB P0704S) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... T4 PNK 3’ phosphatase minus (New England BioLabs, M0236S) was used.
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 ul T4 PNK - 3’ phosphatase minus (NEB M0236L). Samples were then washed 3 times on a magnetic rack with PNK wash buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... after which 3 μL USER enzyme (New England Biolabs) was incubated with size-selected ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using 3-part Gibson assembly reaction (New England Biolabs). αCat cDNAs carrying various mutations (Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... 3 µL DNA polymerase I (50,000 U/ml NEB) and 80 µL deionized H2O ...
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.