Labshake search
Citations for New England Biolabs :
551 - 600 of 1774 citations for 6 Quinoxalinamine N 3 8 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Klenow fragment (3′ → 5′ exo−) (New England Biolabs). Hybridization was performed at 65°C overnight in the pre-hybridization solution containing 6x saline-sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs 3a and 5d) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Biochemistry 2022Quote: ... A-tailing (Klenow fragment (3’-5’ exo–, New England Biolabs), ligation to barcoded adapters (KAPA) ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by A-tailing (Klenow 3’-> 5’ exo-, NEB, M0212S). After A-tailing ...
-
bioRxiv - Bioengineering 2019Quote: ... and 3’-A-tailed with NEBNext dA-Tailing Module (NEB) following the recommendations of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... gDNA (3 μg) was digested by HpaII (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... and 40 U of β1-3 Galactosidase (New England Biolabs) for 16 h at 37°C.
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA (3 μg) was treated with DNase (New England Biolabs) and reverse transcribed using random primer mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genomics 2023Quote: ... and 7.5 U of Klenow fragment 3’→5’ exo-(NEB), except for input DNA that is degraded (e.g. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of Klenow Fragment (3’ -> 5’ exo -, NEB M0212L), 5 μL 50% PEG 8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... A-tailing by Klenow Fragment (3’è5’ exo-; NEB M0212S), and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Genomics 2023Quote: ... 3 uL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 3′ adapter ligation using T4 RNA ligase (NEB). Biotinylated RNAs were enriched for a second time ...
-
bioRxiv - Cell Biology 2020Quote: ... addition of a N-terminal Hemagglutinin (HA) epitope was done using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) following manufacturer recommendations.
-
bioRxiv - Genomics 2020Quote: ... libraries were quantified by qPCR using either the NEBNext® Library Quant kit (New England Biolabs, Cat. N: E7630S) or the KAPA Library Quantification Kit (scRNA-seq libraries only ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified on the streptavidin beads using the EpiMark Hot Start Taq (New England Biolabs, Cat. N: M0490) using following program ...
-
bioRxiv - Biochemistry 2020Quote: ... Glycans were incubated with different exoglycosidases in different sequences: (i) Streptococcus pneumonia β-N-acetylglucosaminidase (GUH, New England Biolabs); (ii ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...