Labshake search
Citations for New England Biolabs :
201 - 250 of 5946 citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl of proteinase k (800 units ml-1, NEB) were added and reacted for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of NEBuffer 2 (New England BioLabs #B7002S), then heating in a thermocycler at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer, NEB, 1 µL of 100 µM gapmer, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP, Hartmann, 6 µL ddH2O) for 40 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... and ∼ 90 ng was used for one-step RT-qPCR using Luna® Universal one-step RT-qPCR kit (New England BioLabs Inc.) [10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription and qPCR were performed in a one-step reaction using Luna® Universal One-Step RT-qPCR (NEB, Ipswich MA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... One microlitre of T4 DNA ligase (NEB, 400,000U/mL) was added to the reaction and incubated at 16 °C to ligate inserts ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... or Luna Universal One-Step RT-qPCR Kit (NEB) and 1.5 μl of reference primer/probe sets CDC-N1 (IDT 10006713 ...
-
bioRxiv - Immunology 2021Quote: ... directly into One Step RT-PCR reaction mix (NEB) loaded in MicroAmp Optical 96-well reaction plates (Applied Biosystems) ...
-
bioRxiv - Genetics 2022Quote: ... was digested for one hour with 50 DpnI (NEB) units to eliminate unreplicated plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... One mL of amylose resine (E8021S, New England Biolabs) was poured into a 1.5 x 10 cm column ...
-
bioRxiv - Synthetic Biology 2023Quote: ... One is to use the restriction enzyme PmlI (NEB) to cut circular plasmids by incubation at 37°C for 2 hours ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... in an all-in-one T7 ligase (NEB#M0318S) based Golden-Gate assembly (37° C for 5min ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Genomics 2019Quote: ... in 1× Buffer 3 (Bionano Genomics) or 120 U of Nb.BssSI (New England Biolabs) in 1× NEBuffer 3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these products were ligated to a 3’ adapter (1× T4 RNA ligase buffer (NEB), 10% PEG-8000 ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for Level 1 and 3 assembly and SapI (New England BioLabs, USA) for Level 2 assembly ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was quantified using a one-step RT qPCR reaction with the NEB Luna Universal Probe One-Step RT-qPCR (New England Biolabs, Ipswich, MA, USA) and the 2019-nCoV RT-qPCR primers and probe (E_Sarbeco)84 on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription and quantitative PCR were performed in one step using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA). The primers used are listed in supplemental table (Table ...