Labshake search
Citations for New England Biolabs :
51 - 100 of 1503 citations for 6 METHYL 3 OXO HEPTANOIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Enzymatic conversion was then performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs, Cat. E7125L) following manufacturers protocol (steps 1.5 to 1.9.11 ...
-
bioRxiv - Genomics 2023Quote: ... 200 ng of sheared DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (E7120; NEB, Ipswich, MA) following the manufacturer’s instructions for large insert libraries ...
-
bioRxiv - Biochemistry 2023Quote: ... formic acid was purchased from Biolabs ltd ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Molecular Biology 2020Quote: EM-seq library construction was performed using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions with modifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... Enzymatic conversion of cleaned sequences was done with NEBNext® Enzymatic Methyl-seq Conversion Module (New England Biolabs, E7125), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted similarly to WGBS protocol above and processed using the NEBNext Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... 200ng of cleaned DNA was used as an input for conversion using a Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Genetics 2023Quote: Whole genome DNA methylation sequencing was performed using the NEBNext Enzymatic Methyl-seq (EM-seq) Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... This was followed by two sets of enzymatic conversion steps using the Enzymatic Methyl-seq kit (NEB, Cat# E7120L) to differentiate cytosines from 5mC and 5hmC ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genomics 2019Quote: ... The adapter ligated DNA fragments were deaminated by the enzymatic deamination method using Enzymatic Methyl-seq Conversion Module (NEB, E7125) or by sodium bisulfite using two commercially available kits ...
-
bioRxiv - Genomics 2021Quote: ... C and 5mC deamination reaction was performed using the APOBEC3A enzyme (NEBNext® Enzymatic Methyl-seq Kit, New England Biolabs) with the following ramping conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated to barcoded adapters (xGen Methyl UDI-UMI Adapters, Integrated DNA Technologies) using concentrated T4 ligase (New England Biolabs) at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each pool was then converted using an enzyme-based conversion to increase the recovery of single cell gDNA compared to standard bisulfite conversion (NEBNext Enzymatic Methyl-seq, New England Biolabs)102 ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Molecular Biology 2022Quote: The library for EM-seq was prepared using 200 ng DNA input and the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) following the manufacturer’s instructions for a standard insert (370-420 bp) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for genome wide DNA methylation profiles were generated from 200 ng of genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs). These libraries were sequenced on an Illumina NextSeq 2000 to generate 100 bp paired end reads.
-
bioRxiv - Bioengineering 2023Quote: ... The APOBEC3A and BSA materials used were purchased from the NEBNext© Enzymatic Methyl-seq Conversion Module kit from New England Biolabs (NEB). The reaction volume was then scaled down to 15.5 uL and modified from the original deamination protocol from the kit ...
-
bioRxiv - Cancer Biology 2024Quote: EM-seq libraries were prepared from genomic DNA as previously (78) using the NEB Enzymatic Methyl-seq kit (New England BioLabs; P7120L). In brief ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...