Labshake search
Citations for New England Biolabs :
1 - 50 of 3551 citations for 6 Chloro 5 methoxypyridin 2 amine hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL 20mg/ml BSA and 5 μL 400U/μl T4 DNA Ligase (NEB, M0202) overnight at 16°C (tumbling ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 2-5 unites of RNase H (New England Biolabs) in 5 µl of 1x RNase H buffer were added to the annealed RNA-chimeric oligo mixture and the RNase H cleavage reaction was performed at 37o C for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µl of Taq 5× Master Mix (New England Biolabs) and Milli-Q water ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... we performed 2 reactions per sample (20 µl 5× NEB Q5 buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate two independent strains expressing Ex[Pcol-10::mCherry::his-58::SL2::drl-1 cDNA] (DLS515 ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...