Labshake search
Citations for New England Biolabs :
251 - 300 of 1803 citations for 6 Chloro 4 iodo 3 pyridinol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sets used were designed by Primer 6 (PREMIER Biosoft Biolabs) (Appendix Table S2) ...
-
bioRxiv - Biochemistry 2019Quote: ... unlabeled AdoMet was left out and 6 μg of MBP2* protein (NEB) was added to each reaction to increase molecular crowding.
-
bioRxiv - Microbiology 2022Quote: ... the reactions were stopped by adding 2µl of 6× loading dye (NEB) containing 20 mM EDTA and analyzed via agarose gel electrophoresis.
-
bioRxiv - Evolutionary Biology 2020Quote: ... SgRNAs were complexed to 6 μg EnGen Spy Cas9-NLS (NEB #M0646) in an approximately 1:1 molar ratio for 15 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... The extract was bound to 6 ml amylose resin (New England Biolabs) for 1 h batchwise ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S), and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µL (12 units) M.SssI methyltransferase (NEB). This solution was pre-warmed to 37°C before addition to prevent interference with dCas9:gRNA binding to the DNA ...
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... in NEB buffer #3 (New England Biolabs, B7003S) for 30 min at 37°C and then ethanol-precipitated after phenol:chloroform and chloroform extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB, M0203S), 1 unit of Klenow Enzyme (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 μl 10 mM dNTP mix (N0477, NEB), and 3 μl Klenow Fragment (exonuclease-deficient ...
-
bioRxiv - Molecular Biology 2022Quote: ... and dephosphorylated with 3 units rSAP (NEB, M0371) with 6 μl CutSmart Buffer (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μL USER Enzyme (NEB, Ipswich, MA, UK) was incubated with size-selected ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Then 3 μl USER™ Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biochemistry 2019Quote: ... and 4ul of 10X NEB buffer 3 (NEB) was added to the reactions and incubated for an extra 20 min at 30°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 U WarmStart RTx Reverse Transcriptase (NEB, #M0380S), 0.2 μM F3/B3 primers ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 3 ul Proteinase K (NEB, P8107S). Samples were incubated for 1 hr at 56°C ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA 3’-ends were dephosphorylated using rSAP (NEB) and ligated to either the Universal miRNA Cloning Linker (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...