Labshake search
Citations for New England Biolabs :
51 - 100 of 2826 citations for 6 Chloro 2 fluoro 3 methylanisole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...