Labshake search
Citations for New England Biolabs :
651 - 700 of 7397 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10% NP-40 (NEB) and 8 μl of PNGase F (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µL RNase H (New England Biolabs), 644 µL buffer A and 2 µL DTT (1M) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4 U murine RNase inhibitor (NEB). TMAO was adjusted to pH 7.5 in a 6 M stock solution with HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 µL 10X CutSmart Buffer (NEB) in a 40 µL reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Microbiology 2019Quote: ... An RNA adaptor (5’ GACCUUGGCUGUCACUCA-3’) was ligated to the 5’-monophosphate of the RNA end by incubation with T4 RNA ligase (NewEngland BioLabs, Inc.), at 25°c for 16 h ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the pML104-GAL1 vector has a guide sequence 5’- CTCTTAAATTATAGTTGGTT-3’ introduced by Q5® Site-Directed Mutagenesis Kit (New England Biolabs) (Hu et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...