Labshake search
Citations for New England Biolabs :
51 - 100 of 1862 citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... EM-seq libraries from both laboratories were prepared using the NEBNext Enzymatic Methyl-seq (E7120, NEB) kit following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... a sequencing library was prepared using NEBNext® Enzymatic Methyl-seq Kit (NEB; catalog number E7120S). Library sequencing was performed using NextSeq 2000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 200 ng DNA using the NEB Enzymatic Methyl-Seq kit (NEB #E7120) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pulse labelled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4 µM final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constructs were subjected to treatment with NEBNext® Enzymatic Methyl-seq (EM-seq™) (NEB, #E7125) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs) were added to improve the efficiency of the reaction ...
-
bioRxiv - Genetics 2023Quote: ... Enzymatic conversion was performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England BioLabs, Cat#E7125S) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Enzymatic conversion was then performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs, Cat. E7125L) following manufacturers protocol (steps 1.5 to 1.9.11 ...
-
bioRxiv - Genomics 2023Quote: ... 200 ng of sheared DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (E7120; NEB, Ipswich, MA) following the manufacturer’s instructions for large insert libraries ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: EM-seq library construction was performed using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions with modifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... Enzymatic conversion of cleaned sequences was done with NEBNext® Enzymatic Methyl-seq Conversion Module (New England Biolabs, E7125), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted similarly to WGBS protocol above and processed using the NEBNext Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... 200ng of cleaned DNA was used as an input for conversion using a Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Genetics 2023Quote: Whole genome DNA methylation sequencing was performed using the NEBNext Enzymatic Methyl-seq (EM-seq) Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... This was followed by two sets of enzymatic conversion steps using the Enzymatic Methyl-seq kit (NEB, Cat# E7120L) to differentiate cytosines from 5mC and 5hmC ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genomics 2019Quote: ... The adapter ligated DNA fragments were deaminated by the enzymatic deamination method using Enzymatic Methyl-seq Conversion Module (NEB, E7125) or by sodium bisulfite using two commercially available kits ...
-
bioRxiv - Genomics 2021Quote: ... C and 5mC deamination reaction was performed using the APOBEC3A enzyme (NEBNext® Enzymatic Methyl-seq Kit, New England Biolabs) with the following ramping conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated to barcoded adapters (xGen Methyl UDI-UMI Adapters, Integrated DNA Technologies) using concentrated T4 ligase (New England Biolabs) at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each pool was then converted using an enzyme-based conversion to increase the recovery of single cell gDNA compared to standard bisulfite conversion (NEBNext Enzymatic Methyl-seq, New England Biolabs)102 ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Molecular Biology 2022Quote: The library for EM-seq was prepared using 200 ng DNA input and the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) following the manufacturer’s instructions for a standard insert (370-420 bp) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for genome wide DNA methylation profiles were generated from 200 ng of genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs). These libraries were sequenced on an Illumina NextSeq 2000 to generate 100 bp paired end reads.
-
bioRxiv - Bioengineering 2023Quote: ... The APOBEC3A and BSA materials used were purchased from the NEBNext© Enzymatic Methyl-seq Conversion Module kit from New England Biolabs (NEB). The reaction volume was then scaled down to 15.5 uL and modified from the original deamination protocol from the kit ...