Labshake search
Citations for New England Biolabs :
151 - 200 of 5974 citations for 6 CHLORO 2 3 4 4A 9 9A HEXAHYDRO 1H CARBAZOLE 1 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2019Quote: ... 9 μg of genomic DNA was then digested to completion with EcoRI (NEB), purified on diatomaceous earth (Carter and Milton 1993 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The coding and reverse oligonucleotides were mixed (6 µL H2O, 1 µL T4 Ligase Buffer, 1 µL T4 PNK (10 U/µL; NEB), 1 µL of each 100 µM oligonucleotide ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the parts were assembled with Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEB, 1h at 50°C) with the linkers providing sequence overlaps ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were washed in CutSmart buffer, and incubated (1h, RT) in 150 µL blunting mix (112.5 µL ddH2O, 15 µL 10x blunting buffer, NEB, 15 µL 100 µM dNTPs ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Developmental Biology 2023Quote: ... Injection mixtures containing 500 ng/µl of Cas 9 protein (NEB; Cat. no.: M0641) and 300 ng/µl of guide RNA were prepared and injected into eggs within 4 hours of egg laying ...