Labshake search
Citations for New England Biolabs :
1 - 50 of 5944 citations for 6 CHLORO 1 2 4 TRIAZOLO 4 3 B PYRIDAZINE 3 THIOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...