Labshake search
Citations for New England Biolabs :
301 - 350 of 6328 citations for 6 Bromo 3 4 dihydro 4 phenyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 15 µL of labeling mix (4 µL 10X ThermoPol Reaction buffer (NEB, B9004S), 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP ...
-
bioRxiv - Bioengineering 2021Quote: ... (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2 ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µl of 10x DNase buffer and 4 µl DNase I (NEB Inc.) were added and incubated at 37°C for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... Mutations in hSlo1 and β1/4 were introduced by PCR-mediated mutagenesis (NEB) using oligonucleotide primers (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... 4% Glycerol and 0.1 mM DTT) with 75 µM S-Adenosylmethionine (SAM, NEB), varying amounts ssRNA and duplex RNA (see above) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was mixed with 7.1 μl H2O and 0.9 μl NEB 4 buffer (NEB). After incubating for 10 min at 96°C ...
-
bioRxiv - Genomics 2023Quote: ... The DGP-4 fragments were then cloned into the AscI/NheI (NEB, USA) site of the p200 vector to construct the sgRNA library (p200 library ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 U/mL creatine kinase) containing 10 µMnt cssDNA (NEB, PhiX virion DNA) was supplemented with Rad51 (5 µM ...
-
bioRxiv - Cell Biology 2023Quote: ... Adapter-ligated DNA was digested with 4 µL of EcoRV-HF (NEB, R3195), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The gel fragments were incubated with 4 mg/mL proteinase K (NEB, P8107) in PK buffer (100 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... The probes were then digested with 4 uL RNaseH (New England Biolabs M0297S) and 4 uL RNaseA (Thermo Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was then digested using DNase I for 2h at 37°C (New England Biolabs) to remove residual plasmid DNA and then purified using Monarch RNA cleanup kit (New England Biolabs) ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... 19 μL binding mixture containing 4 μL nuclear extracts and 5U Rnase H (NEB) or bovine pancreatic RNase A (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: RNA 5’-ends were phosphorylated using 4 µl T4 PNK (NEB, catalog no. M0201) in a solution consisting of 8 µl 10x PNK buffer ...
-
bioRxiv - Zoology 2019Quote: ... 4 µL NEB Deoxynucleotide Solution Mix (10 mM each nt) (New England BioLabs, USA), 1 µL Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Biochemistry 2021Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate GT10 5’_pSY45_pDS66_GT10cHA3 Flox_GT10 3’_pUC19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the supernatant fraction was incubated with 4 ml amylose resin (New England Biolabs, E8021L) for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... then 4 μl of Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0541L) was added to each well ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was added to 4.5 μL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Microbiology 2023Quote: ... gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB). Overnight ligations were transformed into chemically competent DH5ɑ E ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...
-
bioRxiv - Genomics 2023Quote: ... and 30% for overnight at 4 °C) with RNase inhibitor [New England Biolabs (NEB), M0314L ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μL template DNA and 0.4 units of Phusion High-Fidelity DNA Polymerase (NEB) (primer sequences provided in Table S3) ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Genomics 2022Quote: ... 16 µl RNA were mixed with 4 µl LunaScript master mix (NEB cat# E3010L), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Fragmented gDNA (4 μg) was digested with 20 U of RNase H (NEB #M0297S) for 6 hours to serve as a negative control ...
-
bioRxiv - Plant Biology 2023Quote: ... Degalactosylation was done with β1-4 galactosidase following the manufacturer’s instruction (New England Biolabs), and desalted and dried using Sep-Pak C18 cartridge and SpeedVac ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∞ at 4 °C) using NEBNext HighFidelty 2x PCR Master Mix (New England Biolabs, M0541S) and Illumina i5 and i7 indices54 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate TbGT8 5’_BSDr_TbGT8 3’_pUC19 ...
-
bioRxiv - Genetics 2024Quote: ... 120 μL (4 mg/mL) streptavidin magnetic beads (NEB cat no. 50-812-660) were washed 3 times with 1 mL of lysis buffer then resuspended in 100 μL of complete lysis buffer and added to the hybridization mix and then incubated at 37 °C for an additional 30 min with mixing ...
-
bioRxiv - Genomics 2024Quote: ... the DNA was added to 4.5 µL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg of MBP-Rif2 or MBP-Rif2-min (see recombinant protein preparation) was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, 50 μl per reaction). The resin with the immobilized MBP-Rif2 variants was washed 5 times with 1 ml wash buffer (50 mM Tris-HCl pH 7.5 ...