Labshake search
Citations for New England Biolabs :
601 - 650 of 6328 citations for 6 Bromo 3 4 dihydro 4 phenyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Genetics 2022Quote: ... or three (for cloning 4 sgRNAs) fragments were ligated in an equimolar ratio in a Golden Gate reaction with T4 ligase (New England Biolabs) and the BsmBI isoschizomer Esp3I (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... and then chromatin was digested using intact nuclei and 200 U of the 4-base cutter Mbo I (New England Biolabs), and restricted ends religated as described Mumbach et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNAs for each of the 4 constructs were sequentially digested with SacI and BamHI (New England Biolabs, Ipswich, MA), purified by gel electrophoresis ...
-
bioRxiv - Biophysics 2023Quote: ... the mixtures were deproteinized by adding pronase E (4 μg/μl) and 1X purple gel loading dye (New England BioLabs) and incubated at 55°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from ∼4 million N2A cells and fragmented with restriction enzymes (BsrGI, EcoRI, HindIII, SspI, XbaI, 30 U/each, NEB) following a published protocol (89) ...
-
bioRxiv - Genomics 2023Quote: ... The digested gBlock was ligated into the digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µl T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and size selected by running samples on a 1.8% LMT agarose gel at 120 V for 25 minutes at 4°C and gel extracting the mononucleosome band with a Monarch Gel Extraction Kit (T1020S, New England Biolabs). Purified samples were carried forward for qPCR or library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 30 min and then at 60 V (∼4 V/cm) until the pink loading dye was reached in 6x gel loading dye (B7025S, New England Biolabs), which shows a similar migration speed to that of bromophenol blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... a 92-repeat sequence was isolated from a previously verified in-house construct with NheI and NotI restriction digests and subcloned into the MCS of pCDH-EF1-C9up-MCS-C9down-IRES-copGFP with overnight ligation at 4°C (T4 ligase, NEB). To maintain repeat stability ...
-
bioRxiv - Bioengineering 2024Quote: ... pH = 8 for 16 hours at 56°C followed by 30 minutes at 90°C and an additional digest of 4 units of beta-agarase (M0392S, New England BioLabs) for 1 hour at 65°C to ensure full agarose breakdown ...
-
bioRxiv - Genomics 2024Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 µL of 10X CutSmart buffer (New England Biolabs), 60 µM of lab-made synthetic AdoYnATTO643 (Margalit et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µl was added to a 9 µl Luna® Universal One-Step RT-qPCR reaction (NEB, Cat# E3005L). RT-qPCR was carried out to manufacturer specifications in a CFX96 Touch Real Time PCR Machine (Bio-Rad) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... from COLO205 cells was subjected to one-step RT-qPCR analysis using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl of proteinase k (800 units ml-1, NEB) were added and reacted for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...