Labshake search
Citations for New England Biolabs :
251 - 300 of 6607 citations for 6 Amino 5 2 chloro 4 nitrophenyl azo naphthalene 1 sulfonamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Genetics 2019Quote: ... and then treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 30 min at 37°C and finally analyzed by 2% agarose gel electrophoresis.
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Genetics 2021Quote: ... EagI/KpnI-digested ORFs were ligated into the EagI/KpnI-digested pUASTattB vector backbone using a 6:1 insert:vector molar ratio and T4 DNA ligase (M0202S, NEB) in a thermocycler overnight (∼16 hr) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and subsequently mixed at a 6:1 ratio with the digested backbone in reactions containing T4 DNA ligase (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: Activating adaptors containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at OD 0.4-0.6 with 0.1 mM IPTG for 16 hr at 18°C ...