Labshake search
Citations for New England Biolabs :
301 - 350 of 6113 citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Cell Biology 2019Quote: ... and pcDNA4/TO (forward primer 5’ GACACGTGAGAGGGAGTAGAAGCCGCTGATCAGCCTCGACTG 3’ and reverse primer 5’ CAATGGGGCGGAGTTGTTAC 3’) PCR products were assembled using Gibson Assembly (New England Biolabs) [36] ...
-
bioRxiv - Genetics 2019Quote: ... forward (5’-AAGCCAAGTCTGCATGAGTA-3’) and reverse (5’-TAAATGTGCCACTGACTAAAT-3’) followed by a restriction enzyme digestion with Sau96I (New England Biolabs) at 37ºC for 2-3 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... encoding full length Ppp3cc was amplified with primers 5’- AGATTACGCTATCTGTACAGAATTCACCATGTCCGTGAGGCGC-3’ and 5’-GGCCGCTAGCCCGGGTACCGAATTCTTACAGGGCTTTCTTTCCATGGTC-3’ and inserted into pCAG-HA vector using NEB Builder (NEB).
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA for the Ty1 probe was amplified with primers 5’-TGGTAGCGCCTGTGCTTCGGTTAC-3’ and 5’-CATGTTTCCTCGAGTTAGTGAGCCCTGGCTGTTTCG-3’ and Phusion DNA polymerase (New England Biolabs). DNA for the Ty2 probe was generated with primers 5’-TGGTAGCGCCTATGCTTCGGTTAC-3’ and 5’-GCAATATTGTGAGCTTTTGCTGCTCTTGG-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... the PCR products were amplified further with the primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCA-3’ and 5’-GGGGACC ACTTTGTACAAGAAAGCTGGGTC-3’ and Phusion polymerase (New England Biolabs) to add attB adapter sequences ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...