Labshake search
Citations for New England Biolabs :
201 - 250 of 6087 citations for 6 1 4 dioxa 8 azaspiro 4.5 decan 8 yl 3 hydroxy 2 iminopyrimidin 4 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10% NP-40 (NEB) and 8 μl of PNGase F (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µL RNase H (New England Biolabs), 644 µL buffer A and 2 µL DTT (1M) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4 U murine RNase inhibitor (NEB). TMAO was adjusted to pH 7.5 in a 6 M stock solution with HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 µL 10X CutSmart Buffer (NEB) in a 40 µL reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification (8-9 cycles) was performed with 10 μL Fusion HF Buffer (New England Biolabs), 3.125 μL 10uM TruSeq Primer 1 ...
-
bioRxiv - Microbiology 2019Quote: ... and PCR enrichment (8 cycles) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA). DNA concentrations were estimated using qPCR and the Kapa Library Quant Kit (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA (200 ng) was digested with 8 U of high-fidelity ApekI (New England Biolabs, USA) at 75 °C for 2 h.
-
bioRxiv - Genomics 2019Quote: ... 20 ng of the forward backbone was amplified with Len_lib_linF and Len_lib_linR (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB); the minimal promoter and GFP was amplified from 10 ng of the pLS-mP plasmid using minGFP_Len_HAF and minGFP_Len_HAR (Supplemental Table 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M guanidine HCl) containing 8 units/ml and Proteinase K (P8107S, New England Biolabs Inc.) was added freshly to the digestion buffer ...
-
bioRxiv - Genomics 2020Quote: ... each sample(8 μl) was mixed with 12.5 μl 2X Quick Ligation buffer (New England BioLabs), 2.5μL T4 DNA ligase (2000U/μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4.5 µL of Phusion HF Buffer (NEB #B0518S), 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4.5 µL of Phusion HF Buffer (NEB #B0518S), 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...
-
bioRxiv - Microbiology 2019Quote: ... 4 μl of Low Range ssRNA ladder (NEB) or 5 μl RNA molecular weight marker I DIG-labelled (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 U of alkaline phosphatase from Biolabs (# M0290) and 5 mU of phosphodiesterase I from Sigma (# P3243-1VL ...
-
bioRxiv - Genetics 2020Quote: ... 4 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Genomics 2020Quote: ... [4 µl 5x NEB FirstStrand buffer (NEB; E7421AA), 0.25 µl SUPERase-In ...
-
bioRxiv - Neuroscience 2021Quote: ... and the 4 base restriction enzyme Mse1 (NEB) under standard double digest conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 μl of Calf intestinal alkaline phosphatase (NEB) was added to dephosphorylate the RNA for 15 min at 37 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 total U of Proteinase K (NEB) at room temp for 10 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and 4 units of Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl of T4 DNA ligase (NEB, M0202L) were added and the tubes were incubated at room temperature for 4 hours with slow rotation ...