Labshake search
Citations for New England Biolabs :
101 - 150 of 2691 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends of fragments using Klenow fragment (3’ to 5’ exo minus, New England Biolabs), universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... fragmented nascent RNA was dissolved in H2O and incubated with 10 pmol of reverse 3’ RNA adaptor (5’p-rNrNrNrNrNrNrGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC-/3’InvdT/) and T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... were generated by PCR amplification of either full-length pfget4 or nucleotides encoding for the first 246 amino acids of PfGet2CD using PfGet4-EcoRIF (5’-GTACCGGAATTCATGAAAAAGTTCAAATTTAGTAAAGAAAAGCTAGCC-3’)/PfGet4-XhoISalIR or PfGet2CD-BamHIF (5’-GTACGCGGATCCATGGATAAAAATACATTAAAAAGAA-3’)/PfGet2CD-XhoISalIR (5’-AGACCGGTCGACCTCGAGTTATTCATGTTTCGTAATAATAAATTG-3’) primer pairs and subsequently cloning at corresponding sites in pMALc2X plasmid (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... A 3’ RNA adapter /5’Phos/rArGrArUrCrGrGrArArGrArGrCrArCrArCrGrUrC/3’SpC3 was ligated to the samples using T4 RNA Ligase (NEB, M0437M) at room temperature for 75 min.
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 hr with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fragment was amplified by PCR using primers piLepF1 (5“-TCTACAAATCATAAAGATATTGGAAC-3”) and LepR1 (5“-TAAACTTCTGGATGTCCAAAAAAATCA-3”) (Hebert et al., 2004) using OneTaq Mastermix with standard buffer (New England Biolabs) under standard cycling conditions ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... 5’-TTAGAAGAACCGGTCTTCAGTATG-3’ and 5’-CTGTAGGCAAGAAAGCAGAGTATTGTCA-3’) on genomic DNA of pooled or individual embryos followed by digest with XhoI (NEB). Following validation of knock-in ...
-
bioRxiv - Neuroscience 2022Quote: ... primers 5’ caccGGAACAGGCAACATGATTGA 3’ and 5’ aaacTCAATCATGTTGCCTGTTCC 3’ were annealed and golden gate assembled using BpiI (Thermo Fischer) and T4 Ligase (NEB) into s23_U6_scaffoldv2 backbone having BpiI cut sites downstream of U6 promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... (5’-Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3’-InvdT) was ligated to the 3’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...