Labshake search
Citations for New England Biolabs :
1 - 50 of 4780 citations for 4 Triethylsilyl 3 butyn 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-cleaved caspase-3 1:100 (9661, NEB), rat anti-p21 1:100 (ab107099 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Genetics 2024Quote: RNP was complexed by addition of 1 μl of 10 uM Cas9 with 3 μl of 10 uM gRNA in 3 μl NebBuffer r3.1 (NEB B6003S) and 20 μl DNAse/RNase free water ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 to 3 μg plasmid was digested with 1 μl NotI (NEB) for 1 h at 37 °C and heat inactivated prior to transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies: Rabbit anti-Yap1 (Cat# 14074S; 1:300) and Rabbit anti-Smad2/3 (NEB #8685S; 1:300).
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...