Labshake search
Citations for New England Biolabs :
1 - 50 of 1404 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EndoS1 lacking the first 9 amino acids was created by Q5 mutagenesis (New England Biolabs, NEB) by amplifying the full-length construct using primer pairs P154/P155 ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EndoS1 lacking the first 9 amino acids was created by Q5 mutagenesis (New England Biolabs, NEB) by amplifying the full-length construct using primer pairs P154/P155 ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (9 μg) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described in Smola et al. ...
-
bioRxiv - Immunology 2021Quote: ... 9 U RNase Inhibitor (NEB) and 90 U Superscript II (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... before resuspending the beads in 25 μl RNA ligation mix (9 μl H2O, 3 μl 10x T4 RNA ligase buffer (NEB), 0.3 μl 0.1M ATP ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 U of T4 Polynucleotide Kinase (NEB) and 1 U of Klenow fragment (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... 9 U of T4 Polynucleotide Kinase (NEB) and 1 U of Klenow fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 units of T4 Polynucleotide Kinase (NEB) and 1 unit of Klenow fragment (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... 9 U of T4 Polynucleotide Kinase (NEB) and 1 U of Klenow fragment (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 9 U of T4 Polynucleotide Kinase (NEB) and 1 U of Klenow fragment (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and random 9-mer primers (New England Biolabs). Quantitative reverse transcriptase–PCR was performed using SYBR Green Master Mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 mU/μL Escherichia coli RNA polymerase holoenzyme (NEB), 10 μM rNTPs (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... Purified RNAs were random primed using Random Primer 9 (NEB) by incubation at 65°C for 5 minutes followed by rapid cooling on ice ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each transcription reaction consisted of 9 mM rNTPs (NEB N0466), 10 mM Dithiothreitol (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... pMCM8-9 was dephosphorylated with λ-phosphatase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and 200 ng/µl Cas 9 protein (New England BioLabs, M0386T). Injected individuals were screened (see below genotyping procedure ...
-
bioRxiv - Biochemistry 2024Quote: ... N-glycanase treatment was performed by dissolving the samples in 50 mM Tris-HCl (pH 8.0) and 10 nM ethylenediaminetetraacetic acid (EDTA) containing 3 units/μL PNGaseF (New England BioLabs, Inc. MA, USA) and incubated for 4 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 9) rabbit pAb (PTM Biolabs, SKU: PTM 305), Butyryl-Histone H3 (Lys 23 ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... before 9 μl of 5 U/μl thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C with 800 rpm shaking (15 s on/15 s off) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 9 μl of 5 U/μl of thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1 µL 200 ng/µL random nonamer (Random Primer 9, NEB). This mixture was heat denatured at 98° C for 1 minute ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Injection mixtures containing 500 ng/µl of Cas 9 protein (NEB; Cat. no.: M0641) and 300 ng/µl of guide RNA were prepared and injected into eggs within 4 hours of egg laying ...
-
bioRxiv - Biochemistry 2023Quote: ... formic acid was purchased from Biolabs ltd ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by 9 cycles of PCR enrichment using NEB High fidelity PCR kit (NEB, M0541S). The quality of ATAC libraries was assessed with Agilent Bioanalyzer with DNA High Sensitivity kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... 29 μl of purified modified RNA was added to 100 ng Random Primer 9 (NEB) and 0.2 mM of each dNTP ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Biophysics 2024Quote: ... Nucleic acid was treated with DNase (NEB), purified using RNA SPRI beads ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification (8-9 cycles) was performed with 10 μL Fusion HF Buffer (New England Biolabs), 3.125 μL 10uM TruSeq Primer 1 ...
-
bioRxiv - Genomics 2021Quote: ... 500 ng of DNA was dissolved in 9 μL of 1 × CutSmart buffer (New England Biolabs) and sheared by pipetting 30 times with a pipette set at 8 μL with a P2/P10 tip ...
-
bioRxiv - Microbiology 2020Quote: ... and performed 6–9 cycles of PCR with the NEBNext Ultra II Q5 Master Mix (NEB) using Illumina P7 and the Seq-Well P5-TSO hybrid primer (Gierahn et al. ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified for 9-12 cycles using Q5 Hot-Start Mastermix (NEB Cat No M0294L) and primers that added the full Illumina adaptor sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to detect the point mutation in atg-9(bp564) and HinfI (New England BioLabs) was used to detect the point mutations in atg-16.1(gk668615[Q356*] ...
-
bioRxiv - Biochemistry 2024Quote: ... media containing 100 μg/mL ampicillin and 10^9 p.f.u./mL of M13K07 helper phage (NEB) was added for overnight phage amplification at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 9 μl of lysate was mixed to 1 μl of Glycoprotein Denaturing Buffer 10X) (NEB, B1704S). The lysate was denatured at 100°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were amplified for 9 cycles using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L), purified and size-selected with AMPure XP PCR purification beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was collected at 9 h post-IFN treatment using Monarch Total RNA Miniprep Kits (NEB). RNA was prepped for RNA sequencing submission using the NEBNext Poly(A ...
-
bioRxiv - Genomics 2023Quote: ... at 10 pmol each and then amplified in 9 cycles using Phusion DNA polymerase (New England Biolabs) from primers that added flanking overlaps to tiles allowing Infusion cloning in a screening vector ...
-
bioRxiv - Cell Biology 2023Quote: ... (9)C=cell barcode) was used for single-stranded synthesis and Second Strand Synthesis Module (NEB, #E6111) was used for double-stranded cDNA synthesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Exon 9 of daf-2 was amplified with Phusion High-Fidelity DNA polymerase (New England Biolabs, M0530S) using primers F_Primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 µL of RNA was premixed with 1 µL of 200 ng/µL Random Primer 9 (NEB) and 2 µL 100 mM dNTPs (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... all plasmids were mixed and dried in speedvac and re-dissolved in 9 µL 1x Cutsmart (NEB). All digestions were carried out at 37 °C for 90 minutes ...