Labshake search
Citations for New England Biolabs :
1 - 50 of 135 citations for 27 Carboxy 7 keto Cholesterol d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 27% second strand synthesis buffer (NEB), and 13% second strand synthesis enzyme mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The pDyn1 plasmid (the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to a His-ZZ-TEV tag on the aminoterminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Neuroscience 2024Quote: ... The mNeonGreen coding sequence was inserted at the carboxy terminus of GluA1 and GluA2 using NEBuilder HiFi DNA Assembly Master Mix from PCR-derived fragments (New England Biolabs). For flow cytometry ...
-
bioRxiv - Plant Biology 2021Quote: ... 20–27 and the NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Microbiology 2023Quote: ... 27] using the Q5® Site-Directed Mutagenesis Kit (NEB) as per manufacturers protocol ...
-
bioRxiv - Genomics 2020Quote: 27 μL of T4 DNA ligase buffer (10X, New England Biolabs),
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Microbiology 2020Quote: ... eluted in 27 μl of water and subjected to RNase-H (NEB) digestion at 37°C for 30 min followed by heat inactivation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 27) rabbit pAb (PTM Biolabs, SKU: PTM 315).
-
bioRxiv - Microbiology 2022Quote: ... and exon 7 (BSErI, NEB). PCR amplicons were also purified with MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... BS3-d0/BS3-d4 ((bis(sulfosuccinimidyl)suberate-d0/d4, Thermoscientific, Ref. 21590 and 21595), DSBU (Disuccinimidyl Dibutyric Urea, Thermoscientific, Ref. A35459, SNAP-Cell® Block (New England Biolabs Ref. S9106S), glutaraldehyde ...
-
bioRxiv - Cell Biology 2024Quote: ... prophase (7 minutes prior to NEB), and metaphase (1 minute before anaphase onset) ...
-
bioRxiv - Genomics 2023Quote: ... 7 μL Q5 high GC enhancer (NEB), 0.07 μL 100mM dATP ...
-
bioRxiv - Microbiology 2021Quote: ... The pGHJ-TgApiAT6-1 and pGHJ-TgApiAT1 [27] plasmids were linearized by digestion with NotI (NEB) for 2 hr ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 7 μl Polynucleotide Kinase (10 U/µl; NEB) in a total of 100 μl and incubation for 20 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL Murine RNase Inhibitor (New England Biolabs, M0314) was added ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human recombinant histone H2A/H2B dimer (1.5 μg, 54 pmol) and histone (H3/H4)2 tetramer (1.5 μg, 27 pmol) (New England BioLabs) were mixed with the linearised 601 DNA fragments (6 μg ...
-
bioRxiv - Plant Biology 2023Quote: ... 24–27 and were integrated into pENTR1A using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA) to obtain gateway entry clones (pENTR1A-LjbHLH32 and pENTR1A-LjbHLH50) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng DNA was used as input in a first round of PCR (25–27 cycles, Q5 hot start high-fidelity DNA polymerase, New England Biolabs) to amplify the genomic loci of interest and attach common overhangs ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 ng of DNA was inputted into a first round of PCR (27 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to attach common overhangs and amplify the target locus ...
-
bioRxiv - Neuroscience 2024Quote: ... into a pAM-FLEX AAV2 backbone that had been modified to replace DIO with fDIO sequences.27 PCR amplicons were generated using Q5 DNA polymerase (NEB). Plasmids were propagated at 30°C in Stable cells (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmid-carrying bacterial cells were transferred from their respective agar stabs onto agar plates containing 100 µg/mL of Ampicillin or 50µg/mL of Kanamycin and incubated overnight at 37°C (DH5alpha) and 27°C (NEB stable). Alternatively ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... 7 μL of NEBNext Ultra II End Prep Enzyme buffer (NEB) and 3 μL of NEBNext Ultra II End Prep Enzyme Mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic (g)DNA was extracted from muscle biopsies (from n=27 participants) and isolated using the Monarch kit for DNA isolation (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were transferred to 7 ml of 1.15x T4 ligation buffer (NEB), incubated with 1% Triton X-100 for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Genomics 2022Quote: ... A restriction digestion mix containing 7 µl of 10X NEB CutSmart Buffer (NEB #B7204), 4.5 µl of NlaIII (NEB #R0125) ...
-
bioRxiv - Developmental Biology 2020Quote: 5-7 μg of HiC library in a total volume of 100 μl (1x NEB buffer 2.1 ...
-
bioRxiv - Genetics 2021Quote: ... 7 μg of ligated chromatin was digested with 10U specific second cutter NlaIII (R0125S, NEB) in 100 μl system with CutSmart Buffer (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μL of the processing reaction products were treated with 10 units Quick CIP (NEB) in 1X CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: SLC25A46 was amplified through PCR with Taq-polymerase with 7-deaza GTP/nucleotide mix (NEB) using cDNA from control fibroblasts as a template and cloned into Gateway modified pBABE-Puro using Gateway Cloning Technology (Invitrogen) ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... Mutant segment 7 plasmids were generated through Q5 Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...