Labshake search
Citations for New England Biolabs :
51 - 100 of 1632 citations for 10 PROPOXY DECANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using Monarch® Nucleic Acid Purification Kit (New England Biolabs Inc.).
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The extracted nucleic acids were fragmented using a restriction enzyme cocktail with BsrB I (NEB, R0102S), HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 10 μl reaction using 10 U T4 RNA ligase (New England Biolabs) in 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µl of 10×CutSmart Buffer and 10 µl of Hae III (NEB, #R0108L) were added to each tube ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μL RNAs were mixed thoroughly with 1 μL T4 PNK (10 U, NEB), 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 units BsaI (NEB #R3733), 10 units PNK (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units BsaI-HFv2 (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl MboI (NEB R0147S), 5 μl CviQI (NEB R0639S) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mm NTP mix (NEB), Ribolock (Thermo scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli cells (NEB 10-beta). The recombinant N-terminal His6-tagged TrxA protein encoded by slr0623 was expressed and purified as previously described previously for His-tagged proteins (Lapina et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 U BsaI-HFv2 (NEB) for assembly into levels 1 and 3 or 10 U BpiI (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 10 µg λ DNA (NEB) was added to a 50 µL reaction with 80 µM biotin-dCTP (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μl PNK enzymes (NEB) and 15 μl of 10mM ATP and incubated at 37°C for 10 mins on a Thermomixture (1400 rpm) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10-beta (NEB C3020) cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 U MseI (NEB, R0525S), 1x ddPCR supermix for probes and 50-300 ng of genomic DNA (gDNA) ...
-
bioRxiv - Biochemistry 2021Quote: ... E.coli (NEB® 10-beta) containing both a Cas effector and gRNA plasmid (Table S3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U T5 exonuclease (NEB) were added ...
-
bioRxiv - Cell Biology 2020Quote: ... with 10 mM VRC (NEB) per coverslip for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 0.23μl 10 mM dNTPs (NEB), 0.08 μl 10 U/μl E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 nL PEG8000 (50%, NEB), 1 nL BSA (20 ng/ml NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 units of BsaI (NEB), and 200 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL PNGase F (NEB) and 10 μL water were added into the reaction system ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U Terminal Transferase (NEB) and ddH2O to a volume of 50 µl ...
-
bioRxiv - Bioengineering 2023Quote: ... 10-beta cells (NEB #C3020K) or TOP10 (Invitrogen #C404010 ...
-
bioRxiv - Microbiology 2023Quote: ... and 10 nmol ATP (NEB) were added to the annealed products ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 ul rCutSmart Buffer (NEB). The mixes of retrons were organized according to their relative production to retron-Eco1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ATP (NEB, P0756), 10x rCutSmart Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 μl RNase H (NEB), and 70 μl nuclease-free H2O to the cDNA mixture and incubation at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 units PNK (NEB) in 50 μl PNK buffer 1X (30’ at 37°C ...