Labshake search
Citations for New England Biolabs :
101 - 150 of 6083 citations for 1 6 ANHYDRO β D GLUCOSE 2 3 4 TRI O ACETATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from HEK293T cells using Bio Tri RNA reagent (Bio-lab) and mRNA was captured using Oligo d(T)25 magnetic Beads (NEB) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2024Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2L-O-methyltransferase (New England Biolabs). The mRNA was purified ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL of endo-β-N-acetylglucosaminidase-H (Endo-H, EC 3.2.1.96) (New England Biolabs™) and incubated in the thermomixer at 37 °C for one h ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X Protoscript II buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2) 40 U Murine RNase Inhibitor (NEB), 5 mM DTT and pre-incubated for 10 minutes at 42 °C ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4 μl T4 RNA ligase 2 (NEB, catalog no. M0239) for 16 hours at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was harvested from 1 million cells using Bio-TRI® (BioLabs) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Immunology 2024Quote: ... cDNA for 3’ RACE was generated using RNA from IFN-β treated A549 cells using the Template Switch RT Enzyme Mix (NEB, #M0466) and anchored primers ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...