Labshake search
Citations for New England Biolabs :
4851 - 4900 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Receptor cDNAs were amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) from cDNA of mixed-stage populations of wild-type C ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs (NEB) #M0492 ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs (NEB) #M0492 ...
-
bioRxiv - Cell Biology 2022Quote: SLC25A46 was amplified through PCR with Taq-polymerase with 7-deaza GTP/nucleotide mix (NEB) using cDNA from control fibroblasts as a template and cloned into Gateway modified pBABE-Puro using Gateway Cloning Technology (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... The eluted transposed DNA was subjected to PCR amplification using Q5 High-Fidelity Polymerase (NEB) for 7 cycles ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were used as the template for in vitro transcription (NEB, Cat. E2040S) followed by reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... transcription template was generated by PCR using Q5 high fidelity DNA polymerase (New England Biolabs) with dNTP (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Both the PCR product and the recipient plasmid were digested with XhoI and BamHI (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Genetics 2022Quote: ... PCR product sizes were determined by comparison with 50 bp DNA ladder (New England Biolabs) using ImageLabTM software (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions (50 µl) contained 1.0-unit Phusion DNA polymerase (New England Biolabs catalog # M0419), 1X Phusion HF buffer ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR product was transcribed using HiScribe T7 High Yield RNA Synthesis Kit (E2040S; NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Assembly of PCR fragments with the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs) was used to replace the EBOV VP30 by a (codon-optimized ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR amplification of all target regions was performed using LongAmp Taq 2X Mastermix (NEB #M0287). Amplicon size was verified using gel electrophoresis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently DNA was purified using Monarch PCR & DNA Cleanup Kit (New England BioLabs, #T1030). DNA fragments were amplified with PCR and samples were barcoded using published primers (36) ...
-
bioRxiv - Genetics 2022Quote: ... PCR product sizes were determined by comparison with 50 bp DNA ladder (New England Biolabs) using ImageLab™ software (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments and linearized pDIA6754 (31) were mixed and assembled using Gibson Assembly (NEB, France) and transformed by heat shock in E ...
-
bioRxiv - Plant Biology 2022Quote: ... was PCR amplified and connected to PIN’s start codon using the EcoRI (New England Biolabs) restriction enzyme ...
-
bioRxiv - Plant Biology 2023Quote: PCR amplification was done using Q5 DNA polymerase and manufacturer guidelines (New England Biolabs Ltd.) and all plasmid constructs were generated by standard molecular cloning techniques and confirmed by Sanger DNA sequencing (TGCA Sequencing Centre ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were purified and digested with 10U of lambda exonuclease (New England Biolabs; M0262) in 1X lambda-exonuclease buffer for 2 hours at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: PCRs were performed in 25 μL volumes using Phusion® High-Fidelity DNA polymerase (NEB) or Q5® High-Fidelity DNA Polymerase (NEB ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... PCR amplification of genes of interest for this study was done with Phusion polymerase (NEB). For pET vector cloning the PCR amplicons were digested with restriction endonucleases NdeI/XhoI for pET29b/pETduet-1 MCS2 or BamHI/SalI for pETduet-1 MCS1 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were recovered from PCR reaction mixtures and agarose gels using Monarch kits (NEB). Oligonucleotides were obtained from Integrated DNA Technologies.
-
bioRxiv - Molecular Biology 2022Quote: ... 50 μL PCR reactions for each gene block were carried out with Phusion polymerase (NEB) using primers gblock_fwd and gblock_rev for 35 cycles (denaturing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina Nextera XT SetA indexes and NEBNext High-Fidelity 2X PCR Master mix (NEB, M0541) are used to amplify the fragmented products of each sample ...
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae D39 chromosomal DNA by PCR using Q5 High-Fidelity DNA polymerase (New England Biolabs). The kanamycin cassette was amplified from pSt-K and the streptomycin cassette from pGMC5-SM-RFP-PFurA-GFP-streptomycin ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... [19,21] Each PCR included 12.5 µL Q5 High Fidelity 2x Master Mix (New England Biolabs), 1.1 µL of either pool 1 or pool 2 10 µM primer master mix ...
-
bioRxiv - Microbiology 2024Quote: ... Each gene was PCR amplified from the plasmids using Q5 polymerase (New England Biolabs; NEB) with the primers 5’-GAAGTGCCATTCCGCCTGACC and 5’-CACTGAGCCTCCACCTAGCC ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) with P5 primer (AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNAGGGCGGCAAGATCGCCG TG ...
-
bioRxiv - Bioengineering 2024Quote: ... The resultant PCR product was reassembled into a tdTomato-containing vector via Gibson assembly (NEB) with a tdTomato insert (sequence ordered as a codon-optimized gBlock from IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... plates that contain unc-104(R551H) allele was selected by genomic PCR and BamHI (NEB) digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... PCRs were carried out using the Q5 Hot Start 2x Master Mix (NEB, Ipswich, MA) according to the manufacturer’s protocol for 30 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR reactions were prepared using the Luna® Universal qPCR Master Mix (NEB). Reactions were run and data analyzed using the QuantStudioTM 7 Flex Real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Linear HDR templates for knockout were PCR amplified using Phusion DNA polymerase (New England Biolabs) with T7 Forward and M13 Reverse primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and the PCR products were subsequently 5’ phosphorylated using T4 polynucleotide kinase (New England Biolabs) and self-ligated by T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... The editing region was amplified with PCR using Q5 High-Fidelity 2X Master Mix (NEB) followed by purification the PCR product using the QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids below 10kb in size were constructed through PCRs and subsequent Hifi assembly (NEB E2621S), according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... was followed by PCR amplification using Phusion high-fidelity DNA polymerase (New England Biolabs; M0530S) for 15 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... Each gene was PCR amplified from the plasmids using Q5 polymerase (New England Biolabs; NEB) with the primers 5’-GAAGTGCCATTCCGCCTGACC and 5’-CACTGAGCCTCCACCTAGCC ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The reaction mix was purified with Monarch® PCR & DNA Cleanup Kit (NEB, Ipswich, MA). Next ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix was prepared for using the Phusion® High-Fidelity DNA Polymerase (NEB) and primer sequences are listed in Table S3 ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... extracted DNA was amplified using a two-stage Phusion High-fidelity DNA polymerase PCR (NEB). In a three-cycle PCR ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplification was performed with Phusion or Q5 High Fidelity DNA Polymerase (New England Biolabs). Primer sequences are provided in Supplementary Table 4.
-
bioRxiv - Genetics 2024Quote: The PCR reaction contents were mixed with 6x DNA loading dye (New England Biolabs, B7024S) and separated on 1% agarose gel prepared in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...