Labshake search
Citations for New England Biolabs :
4651 - 4700 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... The obtained RNA was purified with the Monarch RNA purification kit (New England Biolabs), and reverse transcription (RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then purified with a Monarch PCR & DNA Cleanup kit (New England Biolabs, USA). For IVT reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments then gel-purified using Monarch® Genomic DNA Purification Kit (NEB: #T3010S). The pBAD33 vector was DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the NEB Monarch DNA Cleanup Kit (NEB, T1030) and eluted with 10 µl of elution buffer.
-
bioRxiv - Systems Biology 2023Quote: ... The tagmentation process was promptly neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). The samples were then eluted in a final volume of 20 μL using the Elution buffer.
-
bioRxiv - Molecular Biology 2023Quote: ... IVT products were purified using a Monarch RNA Cleanup Kit (NEB, T2030L, Ipswich, MA) and stored at -80°C.
-
bioRxiv - Developmental Biology 2023Quote: ... were carried out using the NEBridge Golden Gate Assembly Kit (BsmBI-v2) (NEB, #E1602L), using 75 ng of each part and 2 μl of enzyme mix in a 20 μl reaction ...
-
bioRxiv - Immunology 2023Quote: ... followed by the NEBNext Ultra II Directional RNA Library Prep Kit (CAS: E7760S, NEB). Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS ...
-
bioRxiv - Bioengineering 2023Quote: ... using the Monarch Genomic DNA Purification Kit following the manufacturer’s protocol (New England Biolabs). The targeted region in NEAT1 was amplified by PCR (primers in Extended Data Table 2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After gel extraction using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) Gibson Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Library Prep Kit for Illumina (NEB) and paired-end sequencing was performed using an Illumina Novaseq instrument.
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified gDNA was subsequently processed using the EpiMark 5hmC Analysis kit (NEB, cat# E3317) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Point mutants were generated using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Plant Biology 2023Quote: ... desalted using GenepHlow PCR Cleanup Kit (GeneAid) and ligated with T4 DNA ligase (NEB), each step according to manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on the Illumina HiSeq 2500 platform (PE 50bp) ...
-
bioRxiv - Genetics 2023Quote: Sequencing library was constructed by NEBNext ultra II DNA library prep kit (NEB E7103L). 50 million paired-end 50bp reads were obtained for each ChIP and input sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...
-
bioRxiv - Genetics 2023Quote: ... We performed cDNA synthesis from RNA using LunaScript RT Supermix Kit (New England Biolabs) beginning with 500ng of RNA ...
-
bioRxiv - Genomics 2023Quote: ... followed by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440) ...
-
bioRxiv - Genomics 2023Quote: ... The homology vector was cloned by Gibson assembly (Gibson Assembly Master Mix kit, NEB) into a restriction-enzyme digested pCAG backbone plasmid ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was then purified using the Monarch RNA Cleanup Kit (NEB, Cat. No. T2040).
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon gel extraction following the Monarch® DNA Gel Extraction Kit (NEB, Frankfurt, Germany) instructions was used to isolate and purify the cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the cDNA libraries were purified using the Monarch PCR & DNA Cleanup Kit (NEB). High-throughput sequencing was performed on an Illumina NextSeq 550 in paired-end mode with 150 cycles per end.
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were constructed using NEBNext library kits (New England Biolabs, Ipswich, MA, USA) and sequenced on a NextSeq 550 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... The transcripts were purified with a Monarch RNA Cleanup kit (New England Biolabs, USA). The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... transferred to 50 μl DNA/RNA protection buffer (Monarch Total RNA Miniprep Kit, NEB), and stored in liquid N2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... libraries were prepared using NEBNext Ultra kit (New England Biolabs #E7490, #E7770, #E7335, #E7500) and sequenced using a Nextseq500/550 sequencer ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Gibson Assembly Cloning Kit as instructed by the manufacturer (New England BioLabs). The resulting vector was termed pCEP4-MFAP4 coding for the amino acid sequence M1KAL…IRRA255 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel purification using the Monarch DNA Gel Extraction Kit (New England BioLabs Inc. #T1020L) was performed to extract the shRNA sequence and column purification with the QIAprep PCR Purification Kit (Qiagen #28104 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBNext® UltraTM FS II Library Prep kit (New England Biolabs) with default parameters ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: ... we utilized the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...