Labshake search
Citations for New England Biolabs :
4601 - 4650 of 6440 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were incubated with 0.5 U/ μl T4 RNA ligase 1 (NEB) in 1x ligase buffer (containing 1 mM ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reaction samples were loaded onto 1 ml of amylose resin (NEB). Proteins in the flow-through fractions were further purified by gel filtration chromatography (Superdex 200pg ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were resuspended in 1 X DNAse buffer (New England Biolabs) and then treated with DNAse (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin was washed once by 1× T4 DNA ligase buffer (NEB, B0202) and pelleted by centrifugation.
-
bioRxiv - Molecular Biology 2024Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (NEB, Cat.R0155M) and RsaI (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μL of 5U/ μL Klenow Fragment of DNA polymerase I (NEB) and 2 μL of 10 mM dNTP mix (SERVA ...
-
bioRxiv - Cancer Biology 2024Quote: ... prior to incubation with 1% SDS and proteinase K (20mg/mL, NEB) to inactivate and degrade pA-Tn5 ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfected cells were labeled with 1 µM SNAP-Surface 674 dye (NEB) for 30min followed by washing two times for 10 min with 300 µl MES300 per well ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ug of DNA was incubated with 6U RNAse H (NEB, M0297) at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: 1 µg of each library in pDONR223 was digested with Blp1 (NEB) for 1 h 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 ug of RNA was reverse transcribed using the Lunascript Supermix (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 1 mL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were treated with 1 μl of RNase-free DNase (NEB) to 100 μl of RNA solution and cleaned up with a Monarch RNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.3% Tween 20) with 1 μL proteinase K (800 U/ml, NEB) in 96 well plates ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: SQBs (1 µg) were incubated with 1.0 U/µL DNase I (NEB) with 10 × DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 μL Antarctic Thermolabile UDG (1 U/μL; New England Biolabs, M0372S), 5.4 μL Bst2.0 DNA Polymerase (120 U/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µL of Template Switching RT Enzyme Mix (NEB Catalog# M0466L). After mixing ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of genomic DNA was digested with EcoRI-HF enzyme (NEB) and analyzed using the QX100 system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng genomic DNA was digested with HaeIII (New England Biolabs, R0108L). TBP served as the internal control ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Genetics 2023Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (R0155M; NEB) and RsaI (R0167L ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of template plasmid was digested using 1µL AgeI (NEB, R3552S) for 15h in Cutsmart Buffer (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... endoglycosidase H (500 units, 1 μl, New England Biolabs, catalog no. P0702) was added to each of the SLNYLLYVSN peptide samples ...
-
bioRxiv - Microbiology 2023Quote: ... MNase digestion was performed by addition of 1 μL MNase (NEB, M0247S) at 37 ℃ for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was harvested from 1 million cells using Bio-TRI® (BioLabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... the hybrid was reacted with 1 μl RNase H (New England BioLabs) at 37 °C for 30 min and then heated to 90 °C for 10 min to terminate the reaction ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... except: 1) fragmentation was performed with 30 U PvuII-HF enzyme (NEB) instead of Hpy166II ...
-
bioRxiv - Microbiology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB, #E6440G), followed by 2×150 bp sequencing on the Illumina MiSeq ...
-
bioRxiv - Cell Biology 2023Quote: ... Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs) in 1x PMP buffer supplemented with 100 μM unlabeled ATP ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was digested with 1 unit of MwoI (NEB #R0573S) for 2 hrs at 60°C ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Biophysics 2023Quote: ... The lysates were clarified and loaded on 1 mL chitin resin (NEB) and washed with 1 M KCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 10 mM dNTP mix (NEB N0447S, Ipswich, MA). This initial premix was heated at 65°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl 10 mM mix of dGTP and dTTP (NEB #N0442S, #N0443S), 5 μl 10x T4 DNA Ligase Buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... the reactions were treated with 1 μl of DpnI (New England BioLabs) for 1 hour at 37 °C before gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB E7335) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, USA) was used for multiplexing ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...