Labshake search
Citations for New England Biolabs :
4601 - 4650 of 6874 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 1 unit of Phusion DNA Polymerase (NEB), as well as 10 pg of a pD-template ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL Dnp1 restriction enzyme (NEB, #R0176S) was added to the PCR mixture and the sample incubated at 37 °C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL T4 DNA ligase (NEB M0202M), 15 μL nuclease-free water ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 IU Taq DNA polymerase (NEB). For detection of KPNA2 mRNA a forward primer in exon 1 (5’-GAA GGG TAG CAG ACG TTT CC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... and T4 RNA Ligase 1 (NEB, #M0204S), respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Genomics 2019Quote: ... approximately 1 ug of genomic DNA or WGA-DNA (See Suppl. Table 1) was dephosphorylated with Quick calf intestinal phosphatase (NEB) and CutSmart Buffer (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... RNA adapters with a 5’ inverted dT modification (See Supplementary Table 1) were ligated to the DNase- treated RNA by T4 RNA ligase 1 (#M0204S, New England Biolabs) to render the canonical cleavage products not available for subsequent ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was diluted 1:1 with nuclease-free water and used in Q5® High-Fidelity DNA Polymerase (NEB) reactions (as recommended by the manufacturer ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme (NEB)) and incubated at 37°C for 3 hours with constant shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: BsmBI-digested vector and insert were ligated in a molar ratio of 1:100 to a total of 1 μg using T4 DNA ligase (NEB) for 2 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... was added reconstituted with 1 μg of purified recombinant αS (vendor) in 1 μL of 5X RNA Polymerase Reaction Buffer (New England Biolabs) and incubated at 4°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... ligation reactions with T4 DNA ligase were prepared: 1 μM of ssPCRP was added to 1 μM complementary strands in 1X T4 ligation buffer (NEB) in a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... 20 pmol of the dephosporylated RNA were 5’-end-labeled (20 µCi of 32P-γATP) in a 20 µL reaction for 1 h at 37°C using 1 U polynucleotide kinase (NEB). Labeled RNA was purified on a G50-column (GE Healthcare ...
-
bioRxiv - Biophysics 2024Quote: ... Splint ligation reaction was done by mixing DNA in equal molar ratios of 1 mM in a 20 μl reaction and annealed in 1✕ ligation buffer (NEB) over 4 hours using a thermocycler (bio-rad) ...
-
bioRxiv - Synthetic Biology 2023Quote: Gel electrophoresis was performed using 1 % agarose gels and the ladders used were either Quick-Load 1 kb Extend DNA Ladder (NEB), or Quick-Load Purple 1 kb plus DNA Ladder (NEB).