Labshake search
Citations for New England Biolabs :
4551 - 4600 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... were derived from pESN17 in an equivalent manner using the NEBuilder HiFi DNA assembly kit (NEB). Plasmid pESN69 derived from the assembly of PCR products ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) and sequenced on a high throughput NextSeq 500 device ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep Kit (New England Biolabs), employing on-column digestion of residual DNA by DNAseI treatment ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA purification was performed with the Monarch PCR & DNA Cleanup kit (New England Biolabs, Ipswich, MA), or the DNA Clean & Concentrator Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: ... Single point mutations were introduced by quick- change site directed mutagenesis (Q5-SDM kit (E0554, NEB)) ...
-
bioRxiv - Pathology 2023Quote: ... Isolated small RNAs were subjected for library cloning using the Next Small RNA Prep kit (NEB) and sequenced on an Illumina NextSeq 2000 platform ...
-
bioRxiv - Microbiology 2023Quote: ... to remove residual plasmid DNA and then purified using Monarch RNA cleanup kit (New England Biolabs). RNA was reverse transcribed using SuperScript IV (Invitrogen Life Technologies ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Biochemistry 2023Quote: ... and SDS samples were concentrated using the Monarch PCR & DNA Cleanup Kit (NEB, South Hamilton, MA). Samples were resolved on a 1% agarose TAE gel with ethidium bromide and imaged using BioRad ChemiDoc MP Imaging system (Hercules ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted using Monarch® Total RNA Miniprep Kit (New England Biolabs inc. #T2010S) following manufacturer protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we isolated high molecular weight DNA by following the Monarch T3010 DNA purification kit (NEB, USA) protocol ...
-
bioRxiv - Genetics 2023Quote: ... Completed libraries were quantified using the NEBNext Library Quant Kit for Illumina (New England BioLabs E7630L) and pooled accordingly to a final concentration of 4 nM ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR products were purified using the Monarch® PCR & DNA Cleanup Kit (NEB, T1030) and used as “megaprimers” that are denatured and annealed to the original plasmid (pNG93 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-LAMP reactions were performed using the WarmStart® LAMP Kit (New England Biolabs Cat # E1700) following the manufacturer’s instructions without addition of the fluorescent dye ...
-
bioRxiv - Immunology 2023Quote: ... the NEBNext Ultra II DNA Library Prep Kit for Illumina from NEB (New England Biolabs (NEB), Catalog # E7645 ...
-
bioRxiv - Genomics 2023Quote: ... and sequencing libraries were prepared using the NEBNext Ultra II DNA library kit (New England Biolabs). Samples were sequenced using a paired-end strategy on a NextSeq500 instrument (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated using the NEBNext Ultra II DNA library prep kit (New England Biolabs E7645S) with 14 PCR cycles using unique dual indexes (New England Biolabs E6440S) ...
-
bioRxiv - Genomics 2023Quote: ... ChIP-seq libraries were prepared using the NEBNext Ultra II DNA kit (New England Biolabs, E7645S) using up to 50 ng of input or ChIP DNA ...
-
bioRxiv - Genomics 2023Quote: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced as 40 bp paired-end reads on Illumina NextSeq 500 platform.
-
bioRxiv - Cancer Biology 2023Quote: ... [32P]-labelled AdML pre-mRNA was synthesized in vitro using the T7 HiScribe Transcription Kit (NEB) using [α-32P] UTP (Perkin Elmer ...
-
bioRxiv - Genetics 2023Quote: ... Illumina libraries were generated using the NEBNext Ultra II Dna Library Prep Kit for Illumina (NEB), as described previously49 ...
-
bioRxiv - Genetics 2023Quote: ... CBX1 mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs Inc., E0554S) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Two micrograms of total RNA was circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...
-
bioRxiv - Genomics 2022Quote: ... RNA was harvested 72 hours after transfection using the Monarch Total RNA Miniprep Kit (NEB #T2010). mScarlet and HPRT (housekeeping gene for normalization ...
-
bioRxiv - Genomics 2022Quote: ... NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina® (E7760S, New England Biolabs) and NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (E7645S ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was completed using NEBNext Ultra II Directional RNA Library Prep kits (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645S) with NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The RNA-seq libraries were subjected to two rounds of 75bp paired end sequencing on a NextSeq 550 platform using a 150-cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The CUT&Tag libraries were subjected to 50bp paired end sequencing on a NextSeq 2000 platform using a P2 100-cycle kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 and used for the ligation using the Quick Ligation Kit (New England Biolabs). Specific base pair substitutions were introduced with site directed mutagenesis by polymerase chain reaction (PCR) ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using NEBNext Ultra II DNA library prep Kit for Illumina (NEB #E7645S) according to the manufacturer’s instructions for MNase ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) to produce stranded cDNA libraries ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library preparation using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB), and sequencing was performed at the Yale Stem Cell Center Genomics Core facility ...
-
bioRxiv - Cell Biology 2023Quote: Amplified ssDNA library was purified with the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For this ...
-
bioRxiv - Cell Biology 2023Quote: In vitro transcription was done using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB), following the manufacturer’s instructions for short transcripts ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II DNA library preparation kit (New England Biolabs, E7645L), quantified by Qubit fluorimetry ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 (75 bp in single-end mode ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 platform (75 bp in single-end mode).
-
bioRxiv - Neuroscience 2023Quote: ... and HEK-293 cells were extracted using Monarch Total RNA Miniprep Kit (New England BioLabs, T2010S). To prepare RNA-Seq libraries ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was synthesised using T7 RNA polymerase (HiScribe T7 High Yield RNA Synthesis Kit, NEB, E2040S). Then RNA was reverse- transcribed using a recombinant Moloney leukemia virus reverse transcriptase (GeneAce cDNA Synthesis Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... H259A and H353A were cloned using site directed mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) using primers TCATACAGCAGCGGTCCAGTTAC (forward ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and cloned into pUC19 (digested with EcoRI plus HindIII) using the NEBuilder kit (New England Biolabs). The cloning products were then transformed into E ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... The library was generated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB; 7770), and sequencing was done using the NovaSeq 6000 S4 platform with PE150 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were constructed using the NEBNext II directional RNA library kit for Illumina sequencing (NEB) and sequenced on a NextSeq2000 platform at the Epitranscriptomics and RNA-sequencing facility ...