Labshake search
Citations for New England Biolabs :
401 - 450 of 2440 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant nanobody-displaying phages were rescued with 2×1011 PFU of M13KO7 Helper phage (New England Biolabs). Rescued phages were suspended in 1 ml of phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... purified ∼25−50-nt RNA fragments underwent treatment with recombinant shrimp alkaline phosphatase (New England Biolabs; M0371) to remove 5’-and 3’-phosphates ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2020Quote: Extracted viral RNA was reverse transcribed and tagged with index adaptors using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
bioRxiv - Genomics 2019Quote: ... The DNA (50-100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs M0531) or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then divided into two aliquots and treated with and without 100 U M.CviPI GpC methyltransferase (100 U/million cells; New England Biolabs, M0227B-HI) supplemented with fresh 160 μM S-adenosyl-L-methionine for 15 min at 37ºC ...
-
bioRxiv - Biophysics 2023Quote: ... PUS1D134A lacking the N-terminal HIS-tag was subcloned into expression vector pET21d (EMD Biosciences) using a Gibson Assembly cloning kit and protocol (NEB # E5510S) and sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EWSR1 constructs were created by PCR-based cloning from the His-MBP-EWSR1 expression vector using inverse PCR with Phusion DNA polymerase (New England Biolabs, F530S) then DpnI digest (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2014) by incubating 0.25 μl of plasmid with 1 μl of recombinant Cre recombinase (New England Biolabs M0298S) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... purified RML or ME7 fibrils were prepared as above and digested using recombinant PNGase F (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...