Labshake search
Citations for New England Biolabs :
401 - 450 of 2451 citations for Dengue Virus Serotype 3 Envelope Protein Mouse Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were labelled with the cleavable SNAP-tag probe BG-S-S-649 (featuring the DY-649 fluorophore, a gift from New England Biolabs) in complete medium for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Genetics 2021Quote: Plasmid pNR127.9 was constructed by changing the first rfk-1 stop codon in pNR9.1 from TAG to TGG with primer set 1727/1728 and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Similarly ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5 was removed from pCI-MS2V5-eRF3a F76a plasmid and an N-terminal FLAG tag was inserted to the same plasmid by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). The F76a mutation was mutated back to wildtype using In-fusion cloning (Clontech).
-
bioRxiv - Molecular Biology 2021Quote: To tag the molecular end, HMW genomic DNA (gDNA, see above) was first A-tailed using terminal transferase (NEB M0315) in a reaction by incubating 2ug of gDNA ...
-
bioRxiv - Biochemistry 2022Quote: MBOAT7 mutants were generated by site-directed mutagenesis on the pFBM construct expressing MBOAT7 with a C-terminal GFP and strep tag using the Q5 Mutagenesis Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... a construct was cloned by PCR from the LacZ gene of Escherichia coli MG1655 with a His-tag on the C terminus by Gibson Assembly (New England Biolabs) in a pET-28b vector using the following primers LacZ200 (TAACTTTAAG AAGGAGATAT ACCATGACCA TGATTACGGA TTCACTGGCC GTCGTTTTAC ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... which was assembled with oligo DNA containing Myc or FLAG tag sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The resultant plasmids were named pcDNA3-C-Myc or pcDNA3-C-FLAG ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the gene ctl0382 (homolog of ct127) with a six histidine tag in the reverse primer using Phusion enzyme (NEB), and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The yrbA-fs15 DNA templates (with TAG or TGA stop codons) used for in vitro transcription/translation reactions in the classic PURExpress system (New England Biolabs) were prepared by PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... following the manufacturer’s protocol and adapting the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) System (NEB # 6901S). The human eIF2A coding sequence was cloned into the C-terminal Mxe GyrA Intein-chitin-binding domains (CBD ...
-
bioRxiv - Cell Biology 2023Quote: ... pCIG2-SNAP-M87 (generated for this study from pCIG2-GFP-MACF43 by replacing GFP with SNAP-tag from pSNAPf vector (New England Biolabs) and MACF43 with M87 from pCMV-Tag/WT M87) ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... encoding a C-terminal myc tag were cloned into NcoI and HindIII sites of pHERD20T-myc and pHERD30T-myc using Gibson Assembly (NEB) or Hifi Assembly (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... Specific forward primer targeting E1 and a reverse primer targeting the nongenomic tag were used in 20 ul SYBR Green reaction with 1x Luna qPCR Dye (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... with an N-terminal human CD33 signaling peptide and C-terminal 12xHis purification tag was codon optimized and ordered as a gBlocks Gene Fragment (IDT) with overhangs for Gibson assembly (NEB). The sequence was engineered to have a single Cys in the EC5 domain for site-specific labeling as previously described11 ...
-
bioRxiv - Plant Biology 2023Quote: AtXRCC4 fused to a hexa-histidine followed by a GST tag (pGAT3-atxrcc4) was expressed in BL21(DE3) cells (NEB), The proteins were purified using GST sepharose (Cytiva) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified from afp18-3CTS with primers including a stop codon before the tag and closing the linear fragment using the KLD enzyme mix from New England Biolabs (NEB). Positive clones were confirmed with colony PCR ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminal mEGFP-tag and HSP18 terminator for assembly into pICSL86955 using BsaI (ThermoScientific) restriction enzyme and T4 DNA ligase (New England Biolabs). The GoldenGate restriction-ligation-reaction was transformed into E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...
-
bioRxiv - Developmental Biology 2021Quote: Cas9 protein (M0646, NEB) and sgRNAs against antisense of exons 14 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein (200 µg) was precleared with protein G magnetic beads (New England Biolabs) and incubated overnight (4° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The protein ladder used was Colour Protein Standard Broad Range (NEB, Ipswich, US).
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.