Labshake search
Citations for New England Biolabs :
401 - 450 of 1780 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µL (12 units) M.SssI methyltransferase (NEB). This solution was pre-warmed to 37°C before addition to prevent interference with dCas9:gRNA binding to the DNA ...
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... in NEB buffer #3 (New England Biolabs, B7003S) for 30 min at 37°C and then ethanol-precipitated after phenol:chloroform and chloroform extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB, M0203S), 1 unit of Klenow Enzyme (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 μl 10 mM dNTP mix (N0477, NEB), and 3 μl Klenow Fragment (exonuclease-deficient ...
-
bioRxiv - Molecular Biology 2022Quote: ... and dephosphorylated with 3 units rSAP (NEB, M0371) with 6 μl CutSmart Buffer (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μL USER Enzyme (NEB, Ipswich, MA, UK) was incubated with size-selected ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Then 3 μl USER™ Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biochemistry 2019Quote: ... and 4ul of 10X NEB buffer 3 (NEB) was added to the reactions and incubated for an extra 20 min at 30°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 U WarmStart RTx Reverse Transcriptase (NEB, #M0380S), 0.2 μM F3/B3 primers ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 3 ul Proteinase K (NEB, P8107S). Samples were incubated for 1 hr at 56°C ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA 3’-ends were dephosphorylated using rSAP (NEB) and ligated to either the Universal miRNA Cloning Linker (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 of α2-3,6,8,9 Neuraminidase A (New England Biolabs, Fig. 2d and Extended Data Fig. 2a,b) were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for two hours in NEB Buffer 3.1 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for two hours in NEB Buffer 3.1 ...
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... End repair was performed by adding 20 μl of the End Repair Mix (7 μl of 10x NEB ligation buffer ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nb.BbvCI (NEB, Ipswich, MA, USA) at 37°C for two hours in NEB Buffer 2 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs (NEB), #R0644 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs (NEB), #R0644 ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 15μL gap-fill mix (7 μL Q5 reaction buffer (NEB), 7 μL Q5 high GC enhancer (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were cooled and then digested with DpnII for one hour at 37° C (NEB, R0543). These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′ ...
-
bioRxiv - Developmental Biology 2021Quote: ... The guide RNA was injected into one-cell stage embryos together with Cas9 protein (N.E. Biolabs). Mutant animals were identified by PCR using the following primers ...
-
bioRxiv - Genomics 2019Quote: ... and ligated to indexed P1 adapters (one index per sample) using concentrated T4 DNA ligase (NEB). Ligated DNA was purified using AMPure XP magnetic beads ...
-
bioRxiv - Systems Biology 2019Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs). 1 μl of 10-fold diluted RNA was added to 4 μl of rtPCR mix and subjected to a reverse transcription step at 55°C and 45 cycles of PCR (10 seconds at 95°C and 30 seconds at 60°C) ...
-
bioRxiv - Systems Biology 2019Quote: ... one-third of the DNA sample was amplified using Illumina indexing primers (NEB Catalog no. 7600L). PCR product was size selected by running on 1.5% agarose gel ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... SYBR green based RT-qPCRs were performed using Luna Universal One-Step RT-qPCR Kit (NEB).
-
bioRxiv - Microbiology 2021Quote: One microgram of full-length S protein was treated with 1 μg of FXa (P8010L, NEB), furin (P8077S ...
-
bioRxiv - Genomics 2020Quote: ... One µL of the cDNA was then mixed with Luna qPCR master mix (New England Biolabs) and primers (to a final concentration 100 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs). Primers targeting the MS2 stem-loop regions were used for quantifying repeat RNA expression levels ...
-
bioRxiv - Neuroscience 2022Quote: ... One microgram (1 μg) total RNA was used as an input for mRNA isolation (NEB E7490S), followed by library preparation using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB E7760) ...
-
bioRxiv - Immunology 2020Quote: ... Real time qPCR was performed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...