Labshake search
Citations for New England Biolabs :
401 - 450 of 1774 citations for 6 Quinoxalinamine N 3 8 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Plasmids from O/N cultures were extracted with the Monarch Plasmid Miniprep Kit (New England Biolabs) and sent for sequencing to LGC genomics.
-
bioRxiv - Biophysics 2022Quote: ... The human μOR and V2R were amplified with a SNAP tag at their N-terminal (NEB) and subcloned in the pcDNA4/TO plasmid (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... enzyme digestion or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, Ipswich, MA, catalog #: P0704L) enzyme digestion was performed according to manufacturer’s instruction and the published procedure [49].
-
bioRxiv - Plant Biology 2020Quote: ... were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat n° M0491) with oligonucleotide primers containing attB recombination sequences ...
-
bioRxiv - Immunology 2021Quote: ... the uridines present in one cDNA strand were digested with uracil- N-glycosylase (New England BioLabs), as described 67 ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...
-
bioRxiv - Biophysics 2022Quote: ... containing TwinStrep-SUMO at the N-terminus of S15 using the NEBuilder HiFi assembly protocol (NEB). TnsC clones were transformed into Escherichia coli BL21(DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... or β-N-acetylhexosaminidases (jack bean from Sigma-Aldrich, Streptomyces plicatus chitinase from New England Biolabs or in-house-produced recombinant Caenorhabditis elegans HEX-4 specific for β1,4-GalNAc-linked residues ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 U of Bst DNA polymerase (large fragment; New England Biolabs Inc., Beverly, MA, USA), 1x of the supplied buffer and a variable amount of DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... then immediately mixed with 8 μL NEBNext Second Strand Synthesis Reaction Buffer (New England Biolabs), 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Truncated ric-8 constructs were generated by PCR using high-fidelity Phusion DNA polymerase (NEB). Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Microbiology 2023Quote: ... For the ligation reaction 8 µL of the digest was treated with T4 Ligase (NEB) for 16 hours at 16 °C ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 µM p-Nitrophenyl Phosphate (pNPP) (New England Biolabs Catalog Number P0757S) at 25°C at a pH of 5.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sfGFP1-6-CAM-CB5-mRuby3 were inserted using Gibson assembly (NEB E2611). The insert was amplified with the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... CLAMT1c-Iso2 (Supplementary table 6) were amplified by Phusion polymerase (New England Biolabs) from cDNA (CLAMT1b ...
-
bioRxiv - Biochemistry 2024Quote: ... Eluted proteins were loaded onto a 6 mL amylose column (New England Biolabs), washed in 50 mM HEPES-KOH (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).