Labshake search
Citations for New England Biolabs :
401 - 450 of 7290 citations for 6 METHYL 4 4 NITRO PHENYL 2 OXO 1 2 3 4 TETRAHYDRO PYRIMIDINE 5 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were pelleted at 4℃ and washed once with cold 1.4 × NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4 × NEB buffer 3.1 and treated with 0.1% SDS for 10min at 65℃ ...