Labshake search
Citations for New England Biolabs :
401 - 450 of 6037 citations for 5 5 7 7 Tetramethyl 1 5 6 7 tetrahydrocyclopenta f indazol 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 U/mL Klenow exo- (NEB). Klenow was heat-inactivated and 5 μg E ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl Proteinase K (NEB, NEB, P8107S), 5 µl H2O (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl Proteinase K (NEB, NEB, P8107S), 5 µl H2O (Promega ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 U/µL T7 RNAP (NEB #M0460T), 0.0005 U/µL RNase H (NEB #M0297L) ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
bioRxiv - Neuroscience 2024Quote: NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing (Azenta/Genewiz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 10× blunting buffer (NEB; # B1201SVIAL), 5 μl dNTP 1 mM (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and transformed into NEB 5-alpha (NEB) cells following the manufacturer’s instructions to produce pZIK251.
-
bioRxiv - Immunology 2024Quote: ... and Klenow Fragment (3’-5’ exo-) (NEB) and mixed by gentle tapping ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL dNTP mix (NEB, 2 mM), 1 µL MgSO4 (100 mM) ...
-
bioRxiv - Immunology 2024Quote: ... 5 U of PNK (New England BioLabs), 11.25 μl of 40% PEG8000 and 2.5 ul of 10 μM L3-ATT-App adaptor sequence ...
-
bioRxiv - Genomics 2024Quote: ... 5 μL of T4 Ligase (NEB M0202L), and 10 μL T4 Ligase Buffer (NEB B0202S) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 5 U RNase H (NEB, M0297S) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genetics 2020Quote: ... Only 1 U/μl I-SceI enzyme 5 X/μl buffer (NEB) were mixed when co-injecting with the HDR donor ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Genomics 2024Quote: ... 1 U of Hot Start Taq DNA Polymerase (5 U/μL, NEB), 1X PCR buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using an Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ITS PCR reactions were performed in 25 μl with the following composition: 5 μL 5× buffer containing MgCl2 at 1.5 mM (New England Biolabs), 0.1 mM each dNTP ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2022Quote: ... washing and TRIzol extracted followed by removal of the 5’ cap with 10 U of 5’-pyrophosphohydrolase (RppH) (NEB) and 5’ end repair with T4 PNK (NEB) ...
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... AMX sequencing adaptors were ligated by mixing 2.5 ul of the assembly mix with 5 ul AMX and 5 ul Blunt/TA mastermix from NEB and incubated for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 mM MgCl2) followed by a phosphorylation step of the 5’-terminal ends by the T4 PNK (NEB). This dsDNA duplex was ligated into the large plasmid digested with KpnI (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL of the CspCI digest was mixed with 5 µL of NEBuilder HiFi DNA Assembly Master Mix (NEB), incubated at 50 °C for 15 minutes ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Bioengineering 2024Quote: ... 5’-AGCTACCGACAACAACGTGT-3’ and Cap9_ Kpn/Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI ...
-
bioRxiv - Bioengineering 2024Quote: ... following the manufacturer’s instructions and 3′-O-Me-m7G(5′)ppp(5′)G RNA cap (New England Biolabs, USA) was used as the cap structure analog ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...