Labshake search
Citations for New England Biolabs :
401 - 450 of 5397 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Biochemistry 2021Quote: ... Each reaction was 400 µL total (split into 4 x 100-µL aliquots) and contained 1X Q5 reaction buffer (New England BioLabs), 200 µM dNTPs ...
-
bioRxiv - Biochemistry 2020Quote: ... eluted protein samples may be treated with TEV protease at 4 °C overnight before flowing through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Microbiology 2020Quote: ... was linearized in a 500 μL reaction volume containing 100 units of ApaLI enzyme for 4-6 hours at 37°C in CutSmart buffer (New England Biolabs). The DNA was then ethanol precipitated as previously described (76) ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Microbiology 2020Quote: ... was designed with 4 nt 5’ overhangs that match 5’ overhangs of the pCsm vector left by linearization with BbsI (NEB). 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 4 μM of the green-fluorescent reagent SNAP-cell Oregon green (New England Biolabs) during a 15-min pulse step followed by 30-min wash in fresh medium ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Genetics 2022Quote: ... or three (for cloning 4 sgRNAs) fragments were ligated in an equimolar ratio in a Golden Gate reaction with T4 ligase (New England Biolabs) and the BsmBI isoschizomer Esp3I (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... a 92-repeat sequence was isolated from a previously verified in-house construct with NheI and NotI restriction digests and subcloned into the MCS of pCDH-EF1-C9up-MCS-C9down-IRES-copGFP with overnight ligation at 4°C (T4 ligase, NEB). To maintain repeat stability ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 30 min and then at 60 V (∼4 V/cm) until the pink loading dye was reached in 6x gel loading dye (B7025S, New England Biolabs), which shows a similar migration speed to that of bromophenol blue ...
-
bioRxiv - Bioengineering 2024Quote: ... pH = 8 for 16 hours at 56°C followed by 30 minutes at 90°C and an additional digest of 4 units of beta-agarase (M0392S, New England BioLabs) for 1 hour at 65°C to ensure full agarose breakdown ...
-
bioRxiv - Immunology 2022Quote: ... and then chromatin was digested using intact nuclei and 200 U of the 4-base cutter Mbo I (New England Biolabs), and restricted ends religated as described Mumbach et al. ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNAs for each of the 4 constructs were sequentially digested with SacI and BamHI (New England Biolabs, Ipswich, MA), purified by gel electrophoresis ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2023Quote: ... the mixtures were deproteinized by adding pronase E (4 μg/μl) and 1X purple gel loading dye (New England BioLabs) and incubated at 55°C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from ∼4 million N2A cells and fragmented with restriction enzymes (BsrGI, EcoRI, HindIII, SspI, XbaI, 30 U/each, NEB) following a published protocol (89) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and size selected by running samples on a 1.8% LMT agarose gel at 120 V for 25 minutes at 4°C and gel extracting the mononucleosome band with a Monarch Gel Extraction Kit (T1020S, New England Biolabs). Purified samples were carried forward for qPCR or library preparation ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The target genomic locus was amplified with the primers listed in Supplementary Table 4 using the Q5 Hot Start High-Fidelity Polymerase (NEB). Editing frequencies were assessed by T7E1 assay or targeted amplicon sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... The beads were washed three times with PNK wash buffer and the RNA-protein complexes labeled with 32P with the following reaction: 4 μl 10X PNK buffer (NEB), 2 μl T4 PNK enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... Ig3-4 was purified using the same method as Ig3/Ig4 with the addition of an amylose column (New England Biolabs) chromatography step to remove the MBP tag prior to cation exchange ...
-
bioRxiv - Genomics 2024Quote: ... samples between 4 and 24 mol/µl were amplified by selective whole genome amplification (sWGA) using the enzyme phi29 DNA Polymerase (NEB) before the genotyping ...
-
bioRxiv - Genomics 2024Quote: The efficacy of the methylation protocol was verified by methylation of a control library (CL) (Table 4) followed by enzymatic digestion using BstBI (NEB). 1 μg of both modified and unmodified CLs were mixed with 1 μl enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... was incubated in a reaction volume of 50 µl at 37°C for 18 h with 10 U of T4 beta-glucosyltransferase (T4-BGT) in the presence of 80 µM UDP-glucose in NEBuffer 4 (all New England Biolabs). Control reactions were incubated without T4 beta-glucosyltransferase ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted at 7200rpm for 2min at 4℃ and washed once with cold 1.4× NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4× NEB buffer 3.1 containing 0.1% SDS and incubated at 65℃ for 10min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...