Labshake search
Citations for New England Biolabs :
4251 - 4300 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were in-vitro synthesized using Engen gRNA synthesis Kit (New England Biolabs) according to the manufacturer instruction with synthesis of the double stranded DNA template and transcription of RNA in a single reaction ...
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were then purified using Monarch RNA Cleanup Kit (New England Biolabs T2040L) per manufacturer instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were constructed using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with each pool indexed with a unique dual barcode (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Genomics 2020Quote: ... we used the NEBNext Ultra II FS DNA library kit (New England Biolabs, Inc); the initial enzymatic shearing step was accomplished via 10 minutes of incubation at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... mRNA isolation module in conjunction with their Ultra II RNA directional kit (NEB, E7760) was used to generate libraries for sequencing ...
-
bioRxiv - Immunology 2021Quote: ... cDNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and sequenced on NextSeq 500 System (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, MA, USA) was used to generate sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μg of samples were processed using a commercially available kit (New England Biolabs), PrPC detection was performed using the monoclonal anti-PrPC antibody POM2 as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... All minigene mutations were introduced via Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The nine mutations from eight patients in Orlando et al ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNAs were prepared using the EnGen™ sgRNA Synthesis Kit (New England BioLabs), along with a sg control (g-control- CATCCTCGGCACCGTCACCC) ...
-
bioRxiv - Cancer Biology 2019Quote: ... site-directed mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs) using the primers ACTTGGACGAGCTATTGGAGAAGGC ...
-
bioRxiv - Genomics 2019Quote: ... DNA was repaired and dA-tailed using PreCR and FFPE kits (New England Biolabs) and cleaned with Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2019Quote: ... The mutations were made using the Q5 site directed mutagenesis kit (New England Biolabs). The constructs contained the promoter from the maternal alpha tubulin gene ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The parts were assembled using the NEB HiFi DNA Assembly kit (New England Biolabs) with an incubation time of one hour at 50°C ...
-
bioRxiv - Microbiology 2019Quote: ... Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs GmbH; Ipswich, USA), or innuPREP DOUBLEpure Kit (Analytik Jena ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products were fragmented randomly with the NEBNext® dsDNA fragmentase kit (NEB) and then purified with the AMPure® XP Beads kit (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2(genomic) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Developmental Biology 2019Quote: Pacy-2::acy-2 genomic was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... and capped mRNA was synthesised using the T7 ARCA mRNA kit (New England Biolabs) according to the user’s manual and resuspended in water ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The proA** expression plasmid was constructed using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA depletion was performed using the NEBNext rRNA depletion kit (New England Biolabs). First strand synthesis was achieved using SuperScript III reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... random hexamer and the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). A specific set of primers (Table S10 ...
-
bioRxiv - Genomics 2019Quote: ... followed by library preparation (NEBNext Ultra II DNA Library prep Kit, New England Biolabs), adaptor ligation and index barcoding (Sanger 168 tag set) ...
-
bioRxiv - Molecular Biology 2019Quote: ... If noted PCR products were used to synthesize RNA using T7 polymerase kit (NEB), purified using NEB RNA purification kit and equal amount of purified RNA was used for in vitro reaction (1 - 3ug) ...
-
bioRxiv - Pathology 2020Quote: ... The sequencing library was generated using the Illumina RNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2019Quote: ... Library preparation was performed using the NEBNext Ultra Directional RNA Library Prep Kit (NEB), including double-AMPure bead (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... NEBNext® Ultra™ Directional RNA library prep kit for Illumina® (NEB E7760) and NEBNext® Multiplex oligos for Illumina® (NEB E7335S) ...
-
bioRxiv - Cell Biology 2019Quote: ... ChIRP libraries are constructed using the NEBNext DNA library preparation kit (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... The PCR fragments were stitched together using the Gibson assembly kit (NEB CN# E2611S) following manufacturer’s instructions to yield pJV204 ...
-
bioRxiv - Genetics 2021Quote: ... and the plasmid DNA was extracted using the Monarch® Plasmid Miniprep Kit (NEB). The presence of the correct inserts was done by performing a PCR reaction using the same primers as for the initial target amplification and using the corresponding plasmid DNA as a template.
-
bioRxiv - Genomics 2021Quote: Libraries were prepared with the NEBNext Ultra II FS Library Preparation Kit (NEB, E6177S) according to manufacturer instructions in most steps ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep kit (E7370; NEB) according to the manufacturer’s instructions and submitted for paired-end Illumina sequencing ...
-
bioRxiv - Genomics 2021Quote: ... and converted to cDNA using Ultra II Directional RNA Library Prep Kit (NEB E7760).
-
bioRxiv - Genomics 2020Quote: ... sgRNAs were synthetized with HiScribe T7 high yield RNA synthesis kit (New England Biolabs), incubated together with Cas9 mRNA and then electroporated into fertilized mouse zygotes (see also Supplementary Note 1) ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA was extracted from the gel using Monarch Gel Extraction Kit (NEB, USA). In vitro transcription was then performed using 1μg of purified DNA templates and MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... and Twist Bioscience and assembled by NEBuilder HiFi DNA Assembly kit (New England Biolabs) into pT7-N-His-GST (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... were then purified with a Monarch® PCR & DNA Cleanup Kit (5μg) (NEB T1030S) and DNA concentration and purity measured by NanoDrop™ spectrophotometry (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... RNA synthesis was performed with HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040). One μg of annealed DNA template was used per reaction with 1.5 μL T7 RNA Polymerase Mix ...
-
bioRxiv - Evolutionary Biology 2020Quote: Phage display experiments were performed using the PhD-12 peptide phage display kit (NEB). All steps involving the pipetting of phage-containing samples was done using filter tips (Rainin) ...
-
bioRxiv - Neuroscience 2020Quote: ... We then transcribed each sgRNA in vitro using the HiScribe T7 Kit (NEB, E2040S) with 37°C incubation for 6 hours before treating with DNase at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... first by chloroform extraction and ethanol precipitation followed by Monarch RNA cleanup kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... cDNA was then synthesized using the Protoscript II First Strand cDNA synthesis Kit (NEB). 1 μl of cDNA was amplified by PCR with primers that amplify about 300-600 bp surrounding the sites of interest (outside the length of the antisense domain ...
-
bioRxiv - Bioengineering 2020Quote: ... Amplified DNA was cleaned up with the Monarch DNA Gel Extraction Kit (NEB, T1020S) and samples were submitted to Genewiz for standard Sanger sequencing analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations in FLYC1 were introduced using Q5 site-directed mutagenesis kit (New England Biolabs).
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2021Quote: ... synthesized mVenus fragments were assembled using HiFi Infusion Kit (New England Biolabs, Ipswich, MA) into linearized pUC19 vector (Takara Bio USA ...
-
bioRxiv - Bioengineering 2021Quote: ... was synthesized using the HiScribe T7 ARCA mRNA kit (New England Biolabs, Ipswich, MA) and a linearized double-stranded DNA (Supplementary Figure 8) ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was obtained using a ProtoScript II First Strand cDNA Synthesis Kit (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... which was done with the NEBNext DNA Ultra2 Library Preparation Kit (New England Biolabs). The preparation of the library was performed on an automated liquid handling system (Hamilton Robotics) ...