Labshake search
Citations for New England Biolabs :
4201 - 4250 of 6227 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... mRNA was purified and enriched from 1 µg of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Cell Biology 2022Quote: ... Halt™ Protease and Phosphatase Inhibitor Cocktail in 1X PBS) and then washed twice with either 11 dephosphorylation buffer (1 mM MnCl2, 1X PMP buffer, New England Biolabs, P0753, protease inhibitors) or CN dephosphorylation buffer (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... GAL4-Creb5(1-128)T59/T61A and GAL4-Creb5(1-128)C18/C23S were generated by inducing point mutations in the GAL4-Creb5(1-128) vector using the Q5® Site-Directed Mutagenesis Kit (NEB, Cat#: E0554S). The control vector GAL4(1-147 ...
-
bioRxiv - Microbiology 2020Quote: ... amplified with the primers Dhm1275-1 and −2 (Table 2) using a NEBuilder HiFi DNA Assembly Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 ng total of the purified PCR products were mixed with 1 μl 10× NEBuffer 2 (New England Biolabs Inc., Beverly, MA, USA) and ultrapure water to a final volume of 9.75 μl ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were run on a 1% agarose gel stained with ethidium bromide alongside a 100 bp ladder (New England Biolabs, Ipswitch, MA, USA).
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... fraction #2 of all samples as well as a positive control of U1 snRNP were incubated with 1 μl of proteinase K (NEB, 800 units/ml) for 30 min at 37 °C and loaded onto a denaturing gel (8% acrylamide/bis-acrylamide ...
-
bioRxiv - Pathology 2021Quote: ... The DNA fragment encoding the desired FLAG-TEV tag was generated via PCR using primer pair 2 (table 1) and subsequently cloned into the NdeI restriction site of pET24Δlac/Ep-CoV2 using NEBuilder® HiFi DNA Assembly (NEB, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... genomic DNA libraries were constructed for sequencing on Illumina platforms using the NEBNext® DNA Sample Prep Master Mix Set 1 (New England Biolabs, Ipswich, MA). First ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All DNA fragments were indexed using NEBNext Multiplex Oligos for Illumina (Dual Index Primer sets 1 and 2, New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The transcription levels of the HO-1 gene were detected using the Luna Universal qPCR Master Mix (New England Biolabs Japan, Tokyo, Japan). Real-time PCR was performed using Mastercycler ep realplex2 (Eppendorf ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Bioengineering 2022Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® with the NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) were used to generate DNA libraries for sequencing (New England Biolabs, USA) as per the manufacturers protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 – 1 μg DNA template were in vitro transcribed using HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA), following manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg of RNA was used to generate sequencing libraries using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following polyA selection ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and single colonies were picked 1 day later to grow up and extract plasmid DNA using a Monarch Plasmid Miniprep Kit (New England Biolabs, Cat. No. T1010L). Extracted plasmid DNA was sequence confirmed via long-read Nanopore sequencing (Primordium Labs ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA libraries were constructed from 1 ug input RNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB), following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cell Biology 2022Quote: ... 15 μL of cell lysate was further treated for 1 h at 37°C with 40 units of Quick calf intestinal alkaline phosphatase (CIP, New England Biolabs, Ipswich, MA, USA) per the manufacturer’s recommendations ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genomics 2023Quote: ... We purified and enriched mRNA from 1 ug of total RNA using the NEBNext Poly(A) Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments encoding enriched peptide genes were mixed with sfGFP gene portion and assembled by 1 hour incubation at 50°C using HiFi Master mix (NEB Japan, Tokyo, Japan). The reaction mixture was then used in PCR amplification with primers 13 and 14 to obtain peptide-sfGFP gene fragments suitable for cell-free protein synthesis ...
-
bioRxiv - Molecular Biology 2023Quote: 1 µg of total RNA was used to perform mRNA isolation using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB Cat. No. E7490). The resulting mRNA material was used to prepare the libraries with the use of NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Genomics 2023Quote: ... We then ligated barcodes to the end-prepped DNA using the Native Barcoding Expansion 1–12 kit (EXP-NBD104, Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase Master Mix (New England Biolabs, Ipswich, MA, USA). We cleaned the barcoded samples using 0.9X AMPure XP beads ...
-
bioRxiv - Genomics 2023Quote: ... using the Adapter Mix II from the Native Barcoding Expansion 1–12 kit and NEBNext Quick Ligation Reaction Buffer (New England Biolabs, Ipswich, MA, USA) as well as Quick T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of the supernatant was used as template for PCR using the Q5® High-Fidelity 2X Master Mix (NEB, Cat. # M0492L) and the primer pair prCP222-prCP223 to amplify FCY1 (Table S2) ...
-
bioRxiv - Systems Biology 2024Quote: ... 50 µL reverse-crosslinking buffer (3.33 µL 0.5M EDTA, 1 µL 10% SDS, 2 µL Proteinase K NEB #P8111S, 43.67 µL EB buffer) was added to each sample ...
-
bioRxiv - Plant Biology 2024Quote: ... to create a level-1 plasmid by cut and ligate reaction using BsaI restriction enzyme and T4 DNA ligase from NEB (New England Biosciences). All plasmids were confirmed by restriction digestion and DNA sequencing ...
-
bioRxiv - Biophysics 2024Quote: ... cells were incubated for 2 hours in a dye solution containing 1 µM SNAP-tag ligand BG-AF647 (New England Biolabs, catalog no. S9136S), 1 mM dithiothreitol (neoFroxx ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to do the library according to the manufacturer protocol with the following index set NEBNext Multiplex Oligos for Illumina (Dual-Index Primers Set 1; NEB, cat. no. E7600S) and sequenced on AVT system.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Library preparation for sRNA from sperm samples was done using the New England BioLabs kit NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 (NEB #E7300 and NEB #E7580). The provided guidelines of NEB were followed for small sample preparation until step 15 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Immunology 2024Quote: ... 5’RACE PCR reaction mixes contained: 5 µl of Phusion 5X Buffer (New England Biolabs), 0.5 µl of 10 mM dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 pmol were 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (NEB). The labeled oligo was mixed in equimolar concentrations with the unlabeled reverse complement and annealed by heating at 100°C in a water bath followed by slow cooling ...
-
bioRxiv - Biochemistry 2022Quote: For crystallization the Ioc4 PWWP domain (aa 1-178; Ioc4PWWP) was cloned into a modified pMAL-c2X vector (New England Biolabs, Liu et al., 2001) in order to produce a fusion protein with an N-terminal maltose-binding protein (MBP) ...