Labshake search
Citations for New England Biolabs :
4001 - 4050 of 4797 citations for 8H INDENO 1 2 D THIAZOL 2 AMINE HYDROBROMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... with 20 nM DNA or 50 nM RNA with 1 unit RNase Inhibitor (New England Biolabs Inc., Massachusetts, USA), 100 nM methyltransferase ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB RNAPol reaction buffer (M0251S; 10X) and yeast inorganic pyrophosphatase (YIPP; M2403S; 0.1 U μl−1) were purchased from New England Biolabs (NEB). RNase H was purchased from ThermoFisher Scientific (EN0201 ...
-
bioRxiv - Molecular Biology 2023Quote: For DNA-RNA hybrid IP (DRIP) non-crosslinked lysates were incubated (1 h, 37°C) with 10U RNaseH (NEB) prior to immunoselection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.0-3.0 μg of DNA was used for a ligation reaction in a volume of 1 mL using 1.0 μL of 2000 U/μL T4 DNA Ligase (NEB) for 3C experiments ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The reporter HLC plasmid (20ng μl-1) was digested by 0.5 U I-Sce enzyme in its adequate digestion buffer (NEB) for 30’ at 37°C prior to injections ...
-
bioRxiv - Plant Biology 2023Quote: Mutants in the CG-1 domain were created using the Q5 site-directed mutagenesis kit (New England Biolabs, USA) as per manufacturer instructions ...
-
bioRxiv - Physiology 2023Quote: ... Cleavage of GS linkers from MBP was done in column using 1 unit of TEV protease (Catalog P8112S, NEB) for every 2 µg of fusion protein in 1X TEV buffer (Catalog P8112S ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of immunopurified GST-tagged WRN fragment was phosphorylated in vitro by Casein Kinase II (New England Biolabs) in the presence of 1X NEBuffer (50mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... that can base pair to the 3’ nucleotide of the cDNA products as described.75,76 The reaction was stopped by adding proteinase K (1 unit; New England Biolabs) and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs) ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... Column-bound DNA was eluted in TE buffer (10 mM Tris-Cl, pH 8.0; 1 mM EDTA, pH 8.0) and treated with AsiSI (NEB, R0630S) and PacI (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was isolated from ~1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490). RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) ...
-
bioRxiv - Immunology 2022Quote: ... Then 1 μg of vaccine mRNA was ligated to 20 pmols RA3_7N adaptor: 5rApp/CTGACNNNNNNNTGGAATTCTCGGGTGCCAAGG/3ddC with 10U of T4 KQ227 RNA ligase 1 (#M0204S NEB) in the presence of 20U RNase OUT (#10777019 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tracheal chitin was stained with 505 star conjugated chitin-binding probe (NEB, Frankfurt/M, Germany, used at 1:300). Nuclei were stained with 4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Biochemistry 2022Quote: ... and 10 μM GDP and incubated for 1 h at room temperature prior to adding 0.25 units of Apyrase (NEB) and incubation for a further 1 h at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... reactions were carried out in a total of 25 μL containing 1 X Isothermal Amplification Buffer (New England Biolabs), 5 mM MgSO4 ...
-
bioRxiv - Immunology 2023Quote: 1 μg of total RNA was subjected to rRNA depletion using the NEBNext rRNA Depletion Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µL of T4 DNA Ligase and 1 µL of 10 mM ATP (all reagents from New England Biolabs, Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of the reaction product was treated with 1 μL of CIP or nuclease P1 (New England BioLabs) at 37 °C for 1 h and inactivated at 80 °C for 10 min prior to centrifugation and analysis by HPLC.
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... A cocktail of guide RNAs for each target (1 μL each) was pre-incubated with Cas9 protein (NEB #M0646M) and 0.68uL KCl (as described in (100)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and TE buffer, DNA was reverse crosslinked by incubating beads in Elution buffer (1% SDS, 0.1M NaHCO3 and Proteinase K (NEB)) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCR reaction was set up with 1 µL of the supernatant in a 12.5 µL reaction with Taq polymerase (NEB), according to manufacturer’s instruction.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... each plug was incubated in 160 μl of 1x NEBuffer 3.1 containing 1 unit/μl of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...
-
bioRxiv - Genomics 2023Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... the culture was diluted to 0.1 OD before adding 1 μM silicon-rhodamine benzylguanine derivative SNAP-SiR647 (SNAP-Cell 647-SiR, New England Biolabs). Culture tubes were wrapped in aluminum foil and incubated on a rotator for 15 hours ...
-
bioRxiv - Microbiology 2023Quote: A 10 µL reaction containing 200 ng of pTrc200HA plasmid DNA and 1× CutSmart Buffer (New England BioLabs, USA) with partially purified V2c or its variants normalized by the major V2c protein band was incubated at 37°C for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized from 1 µg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with d(T)23VN primer.
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...