Labshake search
Citations for New England Biolabs :
3951 - 4000 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Molecular Biology 2019Quote: Synthesized guide RNAs were 5’-labeled with 32P using T4 PNK (NEB #M0201) and [γ-32P]ATP (Perkin Elmer #BLU002A250UC ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleotides were dephosphorylated by addition of 5 units of CIP (New England Biolabs) for another 2 hours at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’ caps were removed by incubation with 20 U of RppH (NEB) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM of SNAP-surface549 or SNAP-surface649 (New England Biolabs; Ipswich, MA) was incubated with the beads rotating overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... and purified with Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, Ipswich, USA), checked on an 1 % (w/v ...
-
bioRxiv - Genomics 2020Quote: ... the genome was digested by 5 μl enzyme HaeIII (10 U/μl, NEB) with 81.5 μl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... 5’UTR was obtained using the Template Switching RT Enzyme Mix (NEB #M0466) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: 5’ linker ligation (1x PNK buffer, 40 u T4 RNA ligase I (NEB), 80 u RNaseOUT ...
-
bioRxiv - Genomics 2021Quote: ... In step 5 extra free oligo was removed by Thermolabile Exonuclease I (NEB). After adding 50 ng of carrier DNA (poly (A) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 µL reaction volume contained 2.5 µL Luna® Universal qPCR mastermix (NEB). RT-qPCR analyses were performed using the Real-time PCR Roche Lightcycler 480 and the expression of PP2AA3 (At1G13320 ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ end phosphorylation (1x PNK buffer, 20 U T4 PNK (NEB, Cat# M0201L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated DNA (5 μg) was digested overnight with PstI-HF (New England Biolabs) and resolved on a 0.7% 1x TBE agarose gel stained with SYBR Safe (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... 50 μl of MNAse digestion buffer (5 gelUnits/μl Micrococcal Nuclease (NEB M0247S), 2X Micrococcal Nuclease buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.4 μL Buffer Tag DNA polymerase (5 U/μL, NEB, Cat. No. B9004S), 1.6 μL dNTP (TAKARA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of Luna® Universal qPCR Master Mix (Biolabs, Ipswich, MA, USA) and 2 μl from 1:20 diluted cDNA template.
-
bioRxiv - Biophysics 2023Quote: ... DNA was purified using Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µL of T4 DNA Polymerase (New England Biolabs, catalog No. M0203), and water was added to a final volume of 100 µL ...
-
bioRxiv - Genomics 2024Quote: ... 5 μM each) from IDT were annealed in 1x New England Biolabs (NEB) buffer 2 (20 μl in total) ...
-
bioRxiv - Plant Biology 2023Quote: ... for 5 h in 4ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5 mM CaCl2) combined with DNase I (10 U = 5 μl; NEB, M0303L) at 37°C for 40 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT) or 5 units of RNASEH1 enzyme (M0297, New England Biolabs) for 30 mins at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Trypsin digestion was stopped by adding 5% BSA (ref. B9000S, New England Biolabs) and the cell suspension was passed through a 40 µm Flowmi cell strainer (ref ...
-
bioRxiv - Cell Biology 2023Quote: ... EcoRI and XbaI 5’ overhangs were filled in with dGTP (New England Biolabs), dCTP (New England Biolabs) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 72°C for 5 min) (Phusion High-Fidelity DNA Polymerase, NEB, M0530S) using the P7 and a T7-fused P5 primer (5′ TAA TAC GAC TCA CTA TAG GGA ATG ATA CGG CGA CCA CCG A 3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Plant Biology 2023Quote: ... treated with 5 µg/mL Proteinase K (New England Biolabs Inc., MA, US) for 5 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μL of 300,000 U/mL MNase (New England Biolabs, CAT #M0247S). Efforts were made to avoid freeze-thaw cycles of the MNase enzyme ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was phosphorylated at the 5’ end by T4 polynucleotide kinase (NEB) and ligated to the 5’ adapter (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB) and checked on 1% agarose gel and approximately 600 ng of each PCR product was used as template for in vitro dsRNA synthesis according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were mixed with Hydrophilic Streptavidin Magnetic Beads (5 µl) (NEB #S1421S) and binding buffer (500 µl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Genomics 2023Quote: ... and chromatin was digested during 10 min at 37 °C with 6 Kunitz units of MNase (New England Biolabs, 200 Kunitz units/µl) per 1 million cells ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...